Shakarim University

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22686364	Purchase of office supplies	A4 writing paper is intended for office use and is suitable for printing and copying on laser and inkjet printers, including those using standard and sublimation inks. It is uncoated, white, double-sided offset paper supplied in packs of 500 sheets. The paper has a grammage of 80 g/m², a whiteness of CIE 146%, and an opacity of 94%, which ensures high print quality and good text readability. The paper is ideal for everyday office tasks, document copying, and printing various materials.	Equipment is necessary to implement	3753	2	7506		100%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22684340	Purchase of office supplies	A4 paper ILIM “Standard C” – 3 pcs. Packaging adhesive tape 80 mm × 50 m, transparent – 2 pcs. Sticky notes “Vasy” 12 × 45 mm, arrow-shaped, plastic 023-3602 – 2 pcs. Ballpoint pen, Kazakh brand 50/4000 – 1 pcs.	for the implementation of the project and the preparation of the final report	8528	1	8528		100%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP19678220	Bidistiller BE-4	The Bidistiller BE-4 (SKU 00000033961, Livam, Belgorod) features a capacity of 5 l/h for distilled and 4 l/h for bidistilled water, cooling water consumption of 36 to 88 l/h, bidistillate conductivity of 1.0–1.2 μS/cm, source water pressure of 0.1–0.4 MPa, 220V/50Hz power supply, power consumption up to 6.2 kW, dimensions of 545×305×400 mm, weight of 16.5 kg, a radionuclide purification factor of at least 4000, and a service life of at least 8 years, while the Drying Cabinet ShS-10-02 SPU mod. 2201 (SKU 00010030956) has a 10 l volume, a temperature range of +50 to +200°C, forced convection, and a stainless steel chamber.	To provide an experiment.	685554	1	685554		100%	В период поставки
AP19678220	Drying cabinet ShS-10-02 SPU mod. 2201	The Drying Cabinet ShS-10-02 SPU mod. 2201 features a 10-liter working chamber volume, a temperature range from +50 to +200°C, and a holding time range of 1 to 999 minutes. The unit is equipped with a stainless steel chamber, a forced convection system, programmable temperature settings, and an automatic delayed start function for the drying process. Power consumption does not exceed 0.9 kW, the power supply is 220V/50Hz, overall dimensions are no more than 448×455×406 mm, and the weight is up to 18.5 kg.	To provide an experiment	350000	1	350000		100%	В период поставки

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR28712491	Monoblock	Asus ExpertCenter P400 AiO P470VAK-BPE0490, Core i7-13620H/16GB/1TB/UHD Graphics/LAN/W11H	Purchase of a monoblock for the material and technical base	700000	6	4200000		100%	В период поставки
BR28712491	Laptop	Asus P3605CVA Laptop, Core i7 13620H-2.4 GHz/16"/32GB/2TB/UHD Graphics/W11H	Equipment is necessary to implement the project.	700000	2	1400000		50/50%	В период поставки
BR28712491	"Special interactive panels/tables for museums"	Special interactive panels/tables for museums (Hologram) - 3D display "Round" resolution p1.3 internal, - 3D holographic fan 200*100 cm including delivery and installation	Equipment is necessary to implement the project.	4000000	2	8000000		50/50%	В период поставки
BR28712491	LED screens and media facades	1. LED screens and media facades - 1 indoor P2.5 LED screen, 27.5 sq.m., size 5 x 2.5 m - 1 pc., 5 x 1.5 m - 1 pc., 1.5 x 2.5 m - 2 pcs., including delivery and installation of 1 pc. 2. LED screens and media facades No. 2 - 1 indoor P2.5 LED screen, 20 sq.m., size 5 x 2.5 m - 1 pc., 5 x 1.5 m - 1 pc., including delivery and installation of 1 pc.	Equipment is necessary to implement the project.	10000000	2	20000000	-	50/50%	В период поставки
BR28712491	AR/VR (headsets for MR/VR fields)	AR/VR (MR/VR-field headsets) - Meta Quest 3 virtual reality glasses, including delivery	Equipment is necessary to implement the project.	400000	5	2000000		50/50%	В период поставки
BR28712491	"Holographic displays and holographic systems"	Displays and holographic systems" Golo " - 144×81 cm internal Composite display-column, including manufacturing and installation	Equipment is necessary to implement the project.	600000	5	3000000		50/50%	В период поставки

Барлығы: 6 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP25794135	ion meter ITAN	pH Range: 0.00 – 14.00; resolution: ±0.01–0.1 pH TDS Range: 0 – 10,000 ppm (or higher); depending on sensor Temperature (optional) 0 – 100°C Type: portable or built-in (online sensor) Electrodes: industrial pH electrodes and graphite/platinum TDS electrodes Housing material: resistant to acids and alkalis (PVC, PVDF, glass, stainless steel) Protection rating: IP65–IP68 (moisture resistance for sensors) Interface/Output: LCD display, RS232/RS485 capability, 4–20 mA signal, MODBUS	pH meter/ion meter ITAN are used to control and maintain optimal conditions for the growth and vital activity of microorganisms involved in biological processes. An ion meter measures the total amount of dissolved solids (mineralization), and a pH meter measures the acidity of the medium. These parameters are important for the efficient functioning of the bioreactor.	761600	1	761600		100%	В период поставки
AP25794135	i3 UV-VIS scanning spectrophotometer	Elemental composition: Qualitative and quantitative analysis of elements from Na (Z=11) to U (Z=92) Concentration range: from ppb (ng/mL) to % Detection limit (LOD): from 0.1 to 10 ng (depending on the element) Sample weight: 5–10 µL of solution or <1 mg of dry residue Number of elements: up to 30 simultaneously Analysis time: ~3–10 minutes per sample.	The i3 UV-VIS scanning spectrophotometer can be used to analyze the composition and concentration of elements in biomass obtained during anaerobic fermentation. In the context of an anaerobic fermentation bioreactor, this can serve several purposes: monitoring substrate composition, assessing biomass quality, process control, and analyzing fermentation products. Therefore, using the i3 UV-VIS spectrophotometer in an anaerobic fermentation bioreactor provides important data for process optimization and increased production efficiency.	1050000	1	1050000	-	70/30%	В период поставки
AP25794135	materials for chemical analysis	1. Volumetric flasks 100 ml, 250 ml – 10 pcs 2. Volumetric pipettes – 10 pcs 3. Measuring cylinders – 4 pcs 4. Conical flask KN-3-100 with TС scale, neck 22 – 2 pcs 5. Low laboratory beaker H1-50 ml, 100 ml with graduations, TCS – 4 pcs 6. Ashless filters, blue band, D=18.0 cm, pack of 100 – 2 packs 7. Sample container 120 ml, 250 ml sterile – 6 pcs 8. Microcentrifuge tube 0.5 ml, 1.5 ml, 2 ml – 3 pcs 9. Laboratory funnel – 3 pcs 10. Complete PPE set (nitrile gloves – 50 pcs, acid/nitrile resistant, goggles, mask, apron) – 2 sets	Having a basic set of measuring equipment and consumables is a mandatory minimum requirement for obtaining reliable empirical data. This data serves as the basis for creating a universal mathematical model that allows for predicting biogas yield and quality depending on the feedstock composition and process parameters, which is the primary goal of the project. Without this equipment, the experimental portion of the project is impossible.	159080	1	159080	-	100%	В период поставки
AP25794135	Acids, alkalis for chemical analysis	1. Nitric acid (HNO₃), conc., ρ=1.40 g/cm³ – 4.2 kg 2. Hydrochloric acid (HCl), conc., ρ=1.19 g/cm³ – 2.4 kg 3. Ascorbic acid – 100 g 4. Potassium hydroxide (KOH) – 500 g 5. Sodium hydroxide (NaOH) – 1 kg 6. Citric acid – 500 g 7. Hydroxylamine hydrochloride – 100 g	The acquisition of highly concentrated acids and alkalis is mandatory for the full cycle of analytical work within the project. These reagents are considered consumables and are used at critical stages of sample preparation and quantitative chemical analysis.	42280	1	42280	-	100%	В период поставки
AP25794135	Reagents, alcohols and buffer solutions for chemical analysis	1. Hydrogen peroxide 37%, technical – 1.1 kg 2. Potassium iodide, AR – 0.1 kg 3. Sodium salicylate, AR – 1 kg 4. Potassium rhodanide, AR – 0.1 kg 5. Tin(II) chloride dihydrate, AR – 0.1 kg 6. Buffer solution pH – 2 pcs 7. Trilon B, AR – 0.5 kg 8. Sodium citrate tribasic dihydrate, AR – 0.5 kg 9. Hydroxylamine hydrochloride, AR	These reagents and solutions are necessary for specific quantitative analyses, without which it is impossible to obtain primary data on key parameters of the anaerobic digestion process. These parameters serve as direct input for the calibration and verification of the mathematical model being developed.	135805	1	135805		100%	В период поставки
AP25794135	State Standard Samples (SSS)	Standard samples (CRMs) of each determined element with a concentration of 1.0 mg/cm³	Without using of certified reference materials, all elemental analysis data will be nothing more than estimates, rendering the developed mathematical model incorrect and lacking predictive power. Certified reference materials are a benchmark that provides the necessary level of confidence in the empirical data, which forms the basis for the entire subsequent analytical and modeling system of the project.	43200	1	43200		100%	В период поставки
AP25794135	Laboratory mini centrifuge (7000 rpm)	The mini centrifuge is compact and easy to use, equipped with a durable and transparent polycarbonate lid, resistant to UV. It comes with 2 rotors and adapters for them, allowing placement of 6 x 0.5 ml, 1.5 ml, or 2.0 ml tubes, as well as 16 PCR tubes of 0.2 ml (2 strips of 8 tubes each). The DC motor accelerates the rotor to the set speed with low vibration and operates quietly at less than 45 dB. It guarantees stable operation and high speed accuracy. For user safety, an electronic brake immediately stops the device when the lid is opened.	Equipment is necessary to implement the project.	160700	1	160700		100%	В период поставки

Барлығы: 7 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26195367	Hot-rolled sheet, 5 mm	Hot-rolled steel sheet is a high-quality rolled metal product manufactured from steel blanks using high-temperature heating (up to 1400°C) and subsequent rolling on specialized mills. This process results in the metal achieving physical and chemical homogeneity and superior performance characteristics. Hot-rolled steel sheet 5 mm (metal cutting), steel grade st3sp5, 5x1400x6000 mm	Material is necessary to implement the project.	460000	3	1380000	-	50/50%	В период поставки
AP26195367	Hot-rolled sheet, 3 mm	Hot-rolled steel sheet is a high-quality rolled metal product manufactured from steel blanks using high-temperature heating (up to 1400°C) and subsequent rolling on specialized mills. This process results in the metal achieving physical and chemical homogeneity and superior performance characteristics. Hot-rolled steel sheet 3 mm (metal cutting), steel grade st3sp5, 3x1400x6000 mm	Material is necessary to implement the project.	460000	3	1380000	-	50/50%	В период поставки
AP26195367	20x20x3 mm square steel profile tube	A 20x20x3 mm square steel profile tube is a type of rolled metal product manufactured from carbon structural steel (grades St3sp, St3ps, or 09G2S) using longitudinal electric welding. Cold or hot deformation is used in the manufacturing process, ensuring precise cross-sectional geometry and high strength. This product is a square steel tube with a cross-sectional dimension of 20x20 mm and a wall thickness of 3 mm. It is available in lengths from 6 to 12 meters, weighing approximately 1.42 kg per linear meter. It is manufactured in accordance with GOST 30245-2003 or GOST 8639-82.	Material is necessary to implement the project.	520	1000	520000	-	50/50%	В период поставки
AP26195367	50x30x3 mm square steel profile tub	A 50x30x3 mm square steel profile tube is a rolled metal product manufactured from structural carbon steel (grades St3sp, St3ps, or 09G2S) using longitudinal electric welding. The production process includes hot or cold deformation, ensuring precise profile geometry, structural homogeneity, and high strength properties of the metal. This product is a rectangular steel profile tube measuring 50x30 mm and a wall thickness of 3 mm. The standard length of the tube is 6–12 m, and the weight per linear meter is approximately 3.26 kg. Manufacturing is carried out in accordance with GOST 30245-2003 or GOST 8639-82. This profile tube is characterized by increased rigidity, bending resistance, and ease of welding and installation. It is used in the construction of metal structures, in the manufacture of supports, frames of buildings and structures, furniture elements and mechanical engineering.	Material is necessary to implement the project.	520	1200	624000	-	50/50%	В период поставки
AP26195367	Anti-corrosion paint for metal	Anti-corrosion paint for metal is a specialized paint coating designed to protect metal surfaces from moisture, chemicals, and mechanical damage. It is made from alkyd, epoxy, acrylic, or polyurethane resins with the addition of corrosion inhibitors and anti-corrosion pigments. During application, the paint forms a dense protective film that prevents oxygen and moisture from penetrating the metal surface, thereby significantly extending the service life of structures. It can be used as a stand-alone coating or as part of a multi-layer system (primer + enamel). The product is used for painting metal components, pipelines, frames, supports, and machine and equipment components operating in various climatic conditions. It features high adhesion, UV resistance, and resistance to temperature fluctuations. The mass fraction of non-volatile substances is 60%-65%. Conventional viscosity according to a VZ-245 viscometer with a 4 mm nozzle diameter at a temperature of (20 ± 2) °C 80-160 s Consumption per single-layer coating, g/m2 200 Drying time to degree 3 at a temperature of (20 ± 2) °C and a relative humidity of (60 ± 5)% 30 minutes, no more	Material is necessary to implement the project.	2500	100	250000	-	50/50%	В период поставки
AP26195367	Raspberry pi microcontroller	The Raspberry Pi Pico is a tiny, fast, and versatile board built using the RP2040, a completely new microcontroller. The Raspberry Pi RP2040 features a dual-core Arm Cortex-M0+ processor with 264 KB of onboard RAM and support for up to 16 MB of external flash memory. Flexible I/O options include I2C, SPI, and a unique programmable I/O (PIO).	Equipment is necessary to implement the project.	12000	10	120000	-	50/50%	В период поставки
AP26195367	CNC laser cutting machine	1500W fiber laser. Laser working material: YVO4. Laser wavelength: 1170nm. X-axis travel: 1500mm. Y-axis travel: 3000mm. Z-axis travel: 120mm. Effective cutting range: 3000×1500mm. Positioning accuracy of the working table along the axis: ≤±0.03mm/m. Repeatability of the working table: ≤±0.03mm/m. Maximum positioning speed: 120m/min. Maximum loading capacity of the working table: ≥800kg. Number of phases: 3. Rated supply voltage: 380V, 3 phases, frequency: 50Hz. Power supply protection rating: IP54 Maximum cutting thickness: Carbon steel 12 mm, Stainless steel 6 mm, Aluminum alloy 2 mm, Brass 2 mm. Compressed air supply system (one receiver and refrigerated dryer recommended): Volume: 1 m³, Nominal pressure: 1.5 MPa, Air consumption: 1 l/min. Nominal output voltage: 380 V/50 Hz. Voltage stability: +5%. Auxiliary gas purity requirements for cutting: Oxygen (O2) ≥99.95%, Nitrogen (N2) ≥99.99%.	Equipment is necessary to implement the project.	5000000	1	5000000	-	50/50%	В период поставки
AP26195367	Laser welding machine	Power supply 1 (one 3000W). Generator 1 (one cap) Cold water laser unit (1 pc.) Sheet metal (housing) (1 pc.) Gun holder (1 set) Protective lens (5 pcs.) Equipment acceptance certificate (1 pc.) Pulse power supply (1 pc.) Power supply for oscillating motor (1 pc.) Copper head (8 pcs.) Silk feeder (1 set) Fiber optic cable (1 pc.) Twig 10 meters 3-in-1 functions: Welding, Cleaning, Cutting Power: 3000 W Laser wavelength: 1080 + 10 m Operating mode: Continuous/Modulation Power adjustment range: 10–100% Pointing and location: Red light Optic cable length: 10 m Welding speed: 0–120 mm/s Wire feed speed (standard): 38–600 m/min Wire diameter: 0.8/1.0/1.2/1.6/2.0 mm Cooling method: Water Power supply: 380 VAC/50 Hz Auxiliary gas: Argon/Nitrogen External dimensions: 1120×550×1210 mm Weight: ≈150 kg	Equipment is necessary to implement the project.	3967060	1	3967060	-	50/50%	В период поставки
AP26195367	500kN hydraulic press brake	1. Nominal pressure: 300 kN. 2. Table length: 1600 mm. 3. Distance between bodies: 1280 mm. 4. Neck depth: 190 mm. 5. Ram stroke: 80 mm. 6. Height in open position: 300 mm. 7. Overall dimensions: Length (L): 1860 mm. Width (W): 1700 mm. Height (H): 2000 mm. 8. Main motor power: 4 kW. Electrical control system: the machine uses a three-phase, four-wire power supply, 50 Hz, 380 V. The machine motor is powered by three-phase 380 V, and the lamps are powered by single-phase 220 V. The control transformer is powered by two-phase 380 V. The output of the control transformer provides power to the control circuit: 24 V - for controlling the back stop and the electromagnetic valve. 6V is for indicator lamps and 24V is for other control components.	Equipment is necessary to implement the project.	6500000	1	6500000	-	50/50%	В период поставки
AP26195367	CNC plasma cutting machine	Lateral span: 2200 mm. Effective cutting width: 1600 mm. Length of longitudinal guides (surface roughness of guides Ra≤3.2 μm): 3500 mm. Effective cutting length: 3000 mm. Torch lifting height: 0–120 mm. Cutting speed: 0–6000 mm/min. Cut surface roughness: 12.5 μm ≤Ra≤25 μm. Control system: Shanghai Fangling F2100B. Plasma system power source: Junke CNC 120A. Lifting mechanism: one set. Number of control axes: 2-axis linkage (3- or 4-axis adjustable). Control accuracy: ±0.001 mm. Coordinate range: ±99999.99 mm. Maximum pulse frequency: 200 kHz; The maximum working speed is 15 meters per minute. The maximum number of program lines is 150,000 lines. The maximum size of a single program is 4 million. Time resolution is 10 ms. System power supply is +24 VDC, the power is more than 80 watts. The system operating environment is: temperature from -10 ℃ to +60 ℃; relative humidity is 0-95% without condensation. Includes 48 commonly used graphic libraries (including mesh graphics), with the ability to select sheet size and hole size.	Equipment is necessary to implement the project.	2483786	1	2483786	-	50/50%	В период поставки
AP26195367	Three-axis bending machine for profiles and pipes	3 kW engine, BWD-59-3KW gear motor, diameter within 50 mm, weight 400 kg, dimensions 8008001200 mm (LWH).	Equipment is necessary to implement the project.	1761717	1	1761717	-	50/50%	В период поставки
AP26195367	60×40×3 mm square steel profile tube	A 60×40×3 mm square steel profile tube is a rolled metal product manufactured from structural carbon steel (grades St3sp, St3ps, or 09G2S) using longitudinal electric welding. The manufacturing process includes hot or cold deformation, ensuring precise profile geometry, a uniform metal structure, and high performance characteristics. The product has a rectangular cross-section of 60×40 mm and a wall thickness of 3 mm. The standard tube length is 6–12 m, and the weight per linear meter is approximately 4.08 kg. Production is carried out in accordance with the requirements of GOST 30245-2003 or GOST 8639-82. The tube is characterized by high strength, bending resistance, and ease of welding and machining. It is used in the production of metal structures, load-bearing frames, fences, supports, as well as in mechanical engineering and construction.	Material is necessary to implement the project.	520	1500	780000	-	50/50%	В период поставки
AP26195367	Tool kit	The Universal Tool Set (80-piece kit) is a multifunctional set of hand-held plumbing and assembly tools designed for assembly, repair, and technical work in both domestic and professional settings. All components are made of durable alloy steel with an anti-corrosion coating, ensuring durability and reliability. The set includes: • Hammer — 1; • Pliers — 1; • Ratchet wrenches — 2; • Combination wrenches (sizes 10, 11, 12, 13, 14, 15, 17, 19) — 8; • Pliers — 1; • SL, PH screwdrivers — 5; • Screwdriver holder — 1; • Extension — 3; • Cardan — 2; • Spark plug sockets (16, 21 mm) — 2; • Adapter — 1 pc; • Sockets (4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 19, 22, 24, 27, 30, 32 mm) — 23 pcs; • Extended sockets (5, 6, 7, 8, 9 mm) — 5 pcs; • Hexagon socket wrenches — 6 pcs; • Bit adapter — 1 pc; • T, SL, PH insert bits — 14 pcs; • Plastic storage and carrying case — 1 pc; • Ratchet — 1 pc. All tools are housed in a durable plastic case for easy transport and storage.	Equipment is necessary to implement the project.	83860	2	167720	-	50/50%	В период поставки

Барлығы: 13 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26100207	Densitometer	Measurement range from 0 g/cm3 to 3 g/cm3 Resolution ±0.0001 g/cm3 Repeatability ±0.0001 g/cm3 Accuracy ±0.0003 g/cm3 Injection method Automatic (compatible with manual) Yes Video Yes Temperature control method Peltier Temperature control range 5^∘ C-45^∘ C Temperature control stability ±0.02 ^∘ C Display method 10.4-inch color touch screen FTP Data storage 32G Output method USB, RS232, RJ45, SD-card, U-disk User management Yes / four levels of authority management Audit Trail Yes Electronic Signature Yes User method library Yes Export file for high-level verification MD5 protection Yes Wi-Fi printing Yes Export to multiple file formats PDF and Excel Size 480^* 320^* 200 mm Power supply 110-230 V, 50 Hz/60 Hz. Weight 8 kg	Equipment is necessary to implement	4600000	1	4600000	november	50/50%	В период поставки
AP26100207	Multi-position magnetic stirrer	Power (W): 3600, Display mode: LCD display, Speed range (rpm): 100-1500, Maximum volume of H2O for stirring (L): 5^* 4, Time range: 1 ~ 99 hours 59 minutes, Temperature control range (°C): RT-330, Working size (mm): ϕ150, Motor type: Brushless DC motor, Country of origin: China.	Equipment is necessary to implement	1100000	1	1100000	november	50/50%	В период поставки
AP26100207	Ansys Academic Research Mechanical and CFD	A software suite for computer modeling and analysis of various physical processes using the finite element method. It enables simulations such as strength analysis, fluid dynamics, heat transfer, electromagnetic calculations, and signal integrity analysis, and covers a wide range of engineering and physics problems.	Equipment is necessary to implement	11834144	1	11834144	november	50/50%	В период поставки
AP26100207	Monoblock	Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/8GB/512GB/UHD Graphics/W11SL	Equipment is necessary to implement	400000	9	3600000		50/50%	В период поставки
AP26100207	System unit included in the set.	Intel Core i7 - 14700/64Gb/M.2 2 Tb + Sata 2 Tb/GTX 4060 Ti/1000W	Equipment is necessary to implement the project.	2088896	1	2088896	-	100%	Поставлено
AP26100207	Pen	Ballpoint pen - 1 piece	To provide an experiment.	90	1	90		100%	В период поставки

Барлығы: 6 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26196803	Raw material	Horse meat 300kg3700=1110000 Sunflower oil 50L1000=50000 Rapeseed oil 50L1250=62500Linseed oil 25L5000=125000 Margarine 5kg*1500=7500	Equipment is necessary to implement	1355000	1	1355000	-	100%	В период поставки
AP26196803	Reagents	Hydrogen peroxide concentrated 3L1000=3000 Sulfuric acid concentrated 3kg2000=6000 Hydrochloric acid concentrated 3kg1600=4800 Diethyl ether 3L9500=28500 Reagents for Karl Fischer titration 4pcs*122000=48800	Equipment is necessary to implement	530300	1	530300	-	100%	В период поставки
AP26196803	Karl Fischer Automatic Titrator	TitroLine® 7500 KF: volumetric titration, titration to the end point (SO2, bromine number). Delivery set: titrator, replaceable module WA 10, TM 235 KF stand with integrated stirrer and pump, titration vessel TZ 1770, double platinum micro-electrode KF 1100 and start-up kit, power supply 100-240 V. Dosing volume: 10 ml. Dosing accuracy: 0.15 R%. Dimensions (WxDxH) 153 x 296 x 450 mm. Power supply 100 … 240 V, 50/60 Hz. Manufacturer: SI Analytics, Germany.	Equipment is necessary to implement	7085607	1	7085607		70/30%	В период поставки
AP26196803	Water distiller	Electric Water Distiller AE-5. Production of distilled water for laboratory and technological needs. Electric. Capacity: 5 L/h, body and vessels: stainless steel, 220 V, 50/60 Hz. Power: 1.5 kW. Dimensions (WxDxH): 300 x 250 x 450 mm. Weight: 12 kg. Manufacturer: Russia.	Equipment is necessary to implement	526361	1	526361		50/50%	В период поставки
AP26196803	Soxhlet Extraction Apparatus (portable)	Soxhlet Extraction Apparatus, 300 ml, NS 60/466 Duran. Extraction of fats and other soluble components from solid samples in laboratory conditions. Flask volume: 300 ml. Flask material: Duran glass. Connections: NS 60/466. Durable laboratory apparatus, compatible with various solvents, reusable. Weight: 1.2 kg. Manufacturer: Duran. Country of origin: Germany.	Equipment is necessary to implement	188264	1	188264	-	50/50%	В период поставки
AP26196803	Scientific research service	Аnalysis of physico-chemical properties of vegetable oils and horsemeat fat	Research within the project	600000	1	600000		50/50%	В период поставки
AP26196803	Raw material	Horse meat – 235 kg х 3700 = 869500 Sunflower oil – 50 l х 985 = 49250 Rapeseed oil – 50 l х 1170 = 58500 Linseed oil – 23 l х 4600 = 105800 Margarine – 10 kg х 2174,2 = 21742	Equipment is necessary to implement	1104792	1	1104792		100%	В период поставки

Барлығы: 7 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26198515	Raw material	1 beef 100 kg * 4000=400,000 2 horse meat 80 kg * 3800=304000 3 by-products 100 kg * 2500=250,000 4 intestines (beef, horse, mutton) 100 m * 2400 =240000 5 additional meat raw materials 50 kg * 3000 = 150,000 6 chicken soups 50 kg * 500 = 25000 7 Blood 50 L * 450 =22,500 8 liver 50 kg * 2500= 125000 9 vegetables 50 kg * 400=20,000 10 sunflower oil 50L * 900=45000 11 melange 10 kg * 320 = 3,200	Conducting laboratory work in accordance with the calendar plan	1627700	1	1627700	november	100%	В период поставки
AP26198515	Packaging containers	Used to protect products from damage, contamination, and external factors	Necessary for preserving product quality and protecting against external factors (moisture, contamination, microbial impact).	100	200	20000	november	100%	В период поставки
AP26198515	Мeat roll molds	They define the shape and volume of the product (loaves, rolls), used for cold/warm forming and resting before heat treatment; facilitate the filling of the mince into casings or trays and ensure a uniform appearance of the product	Тo ensure the correct shape and density of the product	2300	10	23000	november	100%	В период поставки
AP26198515	Universal thermal chamber	Comprehensive processing of semi-finished products - cooking (steam/heating), smoking (hot/cold), drying, and curing; provides sterile heat treatment, even heating, humidity control, and/or smoke supply control. Used for boiled, smoked, and semi-smoked sausages. For small workshops, simpler equipment (used or small models) can be selected. When choosing, pay attention to the power of the steam generator, material stainless steel, temperature and humidity control, and smoke generation system	Universal thermal chamber for conducting controlled temperature testing and product processing	7912000	1	7912000	october - november	50/50%	В наличии
AP26198515	Тabletop vacuum sealer	Air removal from packaging and airtight sealing – extends shelf life, prevents oxidation and growth of aerobic microorganisms; used for already chilled products, raw materials, and finished loaves before sale. In industry – either chamber vacuum sealers (for whole loaves) or external “bag” models for small batches. Budget brands/options: the market offers industrial and tabletop/portable vacuum sealers; available brands include Hurakan, VIATTO	Vacuum packaging machine for removing air from packaging	550000	1	550000	november	50/50%	В период поставки
AP26198515	Сutter HURAKAN HKN-CL35MSW	Grinding and emulsifying the meat mass, evenly distributing fat and additives, creating a homogeneous meat emulsion; accelerates the formation of the protein network (important for boiled and semi-smoked sausages), allowing for a smooth texture. According to HURAKAN HKN-CL35MSW: industrial cutter with a 38 L capacity, power ≈5 kW, speed 1400 rpm — suitable for small and medium workshops	The cutter is used to obtain homogeneous and pliable meat mince, improve product texture, and enhance the quality of the finished meat products.	1733140	1	1733140	november	50/50%	В период поставки
AP26198515	Сlipper	Grinding and emulsifying the meat mass, evenly distributing fat and additives, creating a homogeneous meat emulsion; accelerates the formation of the protein network (important for boiled and semi-smoked sausages), allowing for a smooth texture. According to HURAKAN HKN-CL35MSW: industrial cutter with a 38 L capacity, power ≈5 kW, speed 1400 rpm — suitable for small and medium workshops	The clipper is used for reliable sealing of packaging, ensuring airtightness and preserving product freshness	180000	1	180000	november	50/50%	В наличии
AP26198515	laboratory services	Conducting research on chemical, physico-chemical, functional and technological properties and food safety of new natural meat products from additional raw materials. Determination of water activity, determination of pH value, determination of moisture retention capacity (MRC), determination of moisture binding capacity (MBC), determination of fat retention capacity (FRC), determination of chemical composition by the single-sample method, determination of fatty acid composition, determination of color parameters, organoleptic evaluation of meat and meat products, determination of shear force (SF), determination of emulsifying ability, toxicological tests, pesticide analysis, radiological tests.	The study of chemical, physico-chemical, functional and technological properties and food safety indicators of natural meat products from additional raw materials is necessary to assess their quality, nutritional value and technological suitability. Additional meat raw materials differ in composition and structure, which can affect the taste, texture, yield of finished products and resistance to microbiological risks. A comprehensive assessment will make it possible to determine the optimal conditions for its use, ensure safety, improve the quality of final products and use raw materials efficiently.	400000	1	400000	-	50/50%	В период поставки
AP26198515	Sticky photo paper	Self-adhesive photo paper has an adhesive layer on the back, allowing printed photos to be easily stuck to various surfaces without additional glue	Equipment is necessary to implement	2500	20	50000	november-december	100%	В период поставки
AP26198515	Glossy photo paper	Glossy photo paper has a bright, shiny surface that provides high saturation and sharpness of images	Equipment is necessary to implement	3500	20	70000	november-december	100%	В период поставки
AP26198515	A4 paper	A4 paper is a standard paper size (210×297 mm), widely used for printing, copying, and writing. It has good density and a smooth surface, suitable for office and home equipment	Equipment is necessary to implement	2500	4	10000	november-december	100%	В период поставки
AP26198515	Monoblock	Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/16GB/512GB/UHD Graphics/W11SL	Equipment is necessary to implement the project.	500000	5	2500000		50/50%	В период поставки
AP26198515	Lenovo Laptop	Lenovo V15 G5 IRL Laptop, Core i7-13620H/15.6" FHD/16GB/512GB/UHD Graphics/LAN/W11H	To perform work remotely	300000	4	1200000		50/50%	В период поставки
AP26198515	laptop	Asus P1503CVA Laptop, Core i5-13420H/15.6" FHD/8GB/512GB/UHD Graphics/LAN/W11H	To perform work remotely	373	1	373		50/50%	В период поставки
AP26198515	MFP (Color)	MFP HP Color LaserJet Pro M182n, A4, print 600x600dpi, 16/16ppm, сканерлеу 1200dpi, USB, LAN	Equipment is necessary to implement the project	250000	1	250000		50/50%	В период поставки
AP26198515	MFP	HP LaserJet M236dw multifunction printer (MFP), A4, print 600×600 dpi, 29 ppm, scan 600×600 dpi, LCD, LAN	Equipment is necessary to implement	150000	1	150000		50/50%	В период поставки
AP26198515	Raw material	Beef – 50 kg × 3,600 = 180,000 Horse meat – 40 kg × 3,000 = 120,000 Offal (by-products) – 50 kg × 1,500 = 75,000 Casings (beef, horse, mutton) – 50 m × 1,000 = 50,000 Spices (paprika, khmeli-suneli, thyme, marjoram) – 15 kg × 2,500 = 37,500 Marinade – 5 kg × 3,000 = 15,000 Plastic mold – 12 pcs × 2,357 = 28,284	Equipment is necessary to implement	505784	1	505784		100%	В период поставки

Барлығы: 17 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР26197931	Wind pumping unit	Rotor diameter: up to 2.4 m Blade material / quantity: galvanized steel / 18 pcs Start wind speed: not less than 2.5 m/s Operating wind speed: 6–8 m/s Maximum operating wind speed: up to 40 m/s Nominal stroke rate: up to 32 strokes/min Braking system: manual brake Tower height: up to 12 m Total weight (with tower): up to 400 kg Service life: up to 20 years	Equipment is necessary to implement the project.	2700000	1	2700000	october	70/30%	В период поставки
АР26197931	Installation works of the purchased wind-pumping unit.	Installation and commissioning works of the purchased wind-pumping unit above the well.	The service is required for the further implementation of the project.	1100000	1	1100000	october	70/30%	В период поставки
АР26197931	Well drilling	Well drilling with a metal casing pipe of 133 mm diameter. The maximum well depth is 24 meters.	The service is required for the further implementation of the project.	1150000	1	1150000	october	70/30%	В период поставки
АР26197931	Rental of a flatbed cargo truck.	Rental of a flatbed cargo truck	The service is required for the further implementation of the project.	670050	1	670050		70/30%	В период поставки
АР26197931	Rental of a truck crane.	Rental of a truck crane for lifting and installation works.	The service is required for the further implementation of the project.	25000	4	100000	-	70/30%	В период поставки
АР26197931	Steel Pipe	Ø133/4, length 24 m (12х2=24)	Equipment is necessary to implement the project	6177	2	12354	october	70/30%	В период поставки
АР26197931	Rental of a truck-mounted crane (manipulator).	Rental of a truck-mounted crane (manipulator) on a flatbed vehicle for installation and loading/unloading operations.	The service is required for the further implementation of the project.	20000	8	160000	october - november	70/30%	В период поставки
АР26197931	Bench lathe with pedestal	JET BD-11G Desktop Lathe Turning diameter over cross slide: up to 170 mm Spindle speed: not less than 150 rpm — up to 2000 rpm Number of spindle speeds: 6 Spindle taper: MT-4 Spindle bore diameter: up to 26 mm Longitudinal feed range: 0.07 – 0.4 mm/rev Number of longitudinal feeds: 6 Metric thread range: 0.2 – 3.5 mm Number of metric threads: 21 Inch thread: 8 – 56 TPI Number of inch threads: 21 Leadscrew pitch: Tr 20x3 Max tool size: up to 12 × 12 mm Cross slide travel: up to 145 mm Top slide travel: up to 60 mm Tailstock taper: MT-2 Tailstock quill travel: up to 80 mm Quill diameter: up to 30 mm Fixed steady rest range: up to 25 mm Moving steady rest range: up to 25 mm	Equipment is necessary to implement the project.	2300000	1	2300000	-	70/30%	В период поставки
АР26197931	Desktop Drilling Machine with workbench	Power: not less than 750 W Supply voltage: up to 400 V Motor type: asynchronous Spindle speed: not less than 200 rpm — up to 2350 rpm Tool shank diameter: up to 16 mm Belt type: Poly-V 5PJ450 Transmission type: belt Worktable material: cast iron Worktable size (L×W): up to 275 × 245 mm Base size: up to 345 × 520 mm Table tilt angle: up to -45°…+45° Number of spindle speeds: 5 Spindle taper: KM2 Chuck type: keyed Spindle quill travel: up to 96 mm Max distance spindle–table: up to 410 mm Max distance spindle–base: up to 650 mm Base material: cast iron Spindle–column distance: up to 205 mm Laser pointer: yes Lighting: yes Chuck mount: B16 Column diameter: up to 70 mm Fork type: TH-015T Max table load: up to 30 kg Threading function: yes Max drilling diameter in wood: up to 50 mm Power cord length: up to 1.8 m Max drilling diameter in soft metals: up to 20 mm Max drilling diameter in hard metals: up to 18 mm Dimensions (L×W×H): up to 710 × 585 × 1120 mm Packing dimensions (L×W×H): up to 1060 × 610 × 380 mm Net weight: up to 96 kg Gross weight: up to 96 kg Delivery set: 1 pc. Warranty period: 12 months Extended warranty: +24 months Country of origin: China	Equipment is necessary to implement the project.	1449351	1	1449351	-	70/30%	В период поставки
АР26197931	VP-E Metal Workbench with	Dimensions (L × W × H): up to 860 × 1000 × 685 mm Maximum load capacity: up to 500 kg Worktop: MDF desktop covered with galvanized sheet metal Included: hanging drawer, two supports Color: blue RAL 5002 and yellow RAL 1003 (can be painted in any RAL color) Construction: metal workbench, double-cabinet (two pedestals) Model code: VP-E	Equipment is necessary to implement the project.	125000	2	250000		70/30%	В период поставки
АР26197931	Receiver (compressed air storage tank)	Vertical Compressed air inlet/outlet: 1/2 inch Overall dimensions (L × W × H): no more than 570 × 560 × 1000 mm Maximum pressure: not less than 10 atm Weight: no more than 65 kg Body material: Steel St3 Receiver volume: not less than 110 L Ambient temperature: from –20 °C to +100 °C	Equipment is necessary to implement the project.	320000	6	1920000	-	70/30%	В период поставки
АР26197931	Condensate Trap	Maximum pressure: not less than 16 bar Maximum operating temperature: not less than 200 °C Connection diameter: ½" Flow rate: not less than 30 and not more than 180 kg/h Working medium: Compressed air Connection type: Threaded Body material: Zinc alloy	Equipment is necessary to implement the project.	66720	6	400320	-	70/30%	В период поставки
АР26197931	Plastic Water Tank	3 m³, underground	Equipment is necessary to implement the project.	480000	1	480000	-	70/30%	В период поставки
АР26197931	Pneumatic Motor	Motor type: pneumatic rotary Power: up to 2.0 hp (≈ 1.5 kW) Operating pressure: not more than 6.3 bar No-load speed: up to 8,500 rpm Maximum torque: up to 1.5 N·m Air consumption: up to 34 L/s (≈ 2.04 m³/min) Rotation direction: right-hand (R) Weight: up to 1.7 kg Drive type: direct	Equipment is necessary to implement the project	297000	2	594000		70/30%	В период поставки
АР26197931	Compressors	Power: not less than 1.1 kW (≈ 1.5 hp) Operating pressure: not less than 8 bar Maximum pressure: up to 10 bar Tank capacity: not less than 50 L Air delivery rate: not less than 240 L/min Motor type: asynchronous, oil-lubricated Voltage: 220 V / 50 Hz Number of cylinders: 1 Protection: thermal control and auto shut-off Air outlet fitting: 1/4'' Noise level: up to 80 dB Weight: up to 34 kg Dimensions (L×W×H): approx. 780 × 330 × 650 mm Compressor No. 2 - Compressor head 1051 0.75 kW/1HP Voltage: not less than 220 V, 380 V Power source: gasoline Configuration: portable Type: piston Gas type: air Cooling method: air-cooled Sound reduction: no Warranty: not less than 1 year Weight: not less than 35 kg Origin: Zhejiang, China Brand name: MUGE Size (L×W×H): not less than 23×16×23 cm Standard or non-standard: standard Structure: piston pump Use: air compressor pump Power: not less than 0.75 kW Fuel: gasoline Pressure: not less than 8 bar Horsepower: not less than 1 HP Maximum flow rate: not less than 56	Equipment is necessary to implement the project.	115049	2	230098	-	70/30%	В период поставки
АР26197931	Submersible Pump	Type: borehole Design: submersible, multistage Power: ≥ 323 W Frequency: 50 Hz Max head (lifting height): up to 45 m Max submersion depth: up to 50 m Flow rate: ≥ 52.3 L/min Pipe connection: internal thread G1 inch Pump diameter: 80 mm Casing material: stainless steel Water intake position: central Dry-run protection: not included Max liquid temperature: up to 40 °C Min water level: ≥ 789 mm Impeller material: noryl (engineering polymer) For pressure boosting: not intended Connector included: no Cable length: ≥ 20 m Overheat protection: yes Soft start device: no Series: NPCS Rated voltage: 220 V Operating pressure: up to 4.5 bar Min allowable borehole diameter: 100 mm Protection class: IP68	Equipment is necessary to implement the project.	69890	1	69890	-	70/30%	В период поставки
АР26197931	3D Printer	Bambu Lab X1-Carbon Combo Printing method: FDM (fused deposition modeling) Maximum print speed: 500 mm/s Build (working) volume: 256 × 256 × 256 mm Printer dimensions: 389 × 389 × 457 mm Weight: 22.3 kg Warranty: 12 months Display / control: color display with advanced features Software compatibility: Bambu Studio, Cura, SuperSlicer, etc. Controller system: microcontroller (Cortex-M4) + system part (Cortex-A7 + NPU) Supported materials: PLA, PETG, PA-CF and others Version: EU version, intended for Europe and Kazakhstan — provides access to firmware updates, remote control, etc.	Equipment is necessary to implement the project.	1300000	1	1300000	-	70/30%	В период поставки
АР26197931	PLA Plastic	Color available in assortment Material type: thermoplastic polyester (biopolymer) Origin: renewable resources (corn starch, sugarcane, etc.) Melting temperature: 170 – 180 °C Glass transition temperature: ~60 °C Density: 1.23 – 1.25 g/cm³ Tensile strength: ≥ 50 MPa Elongation at break: up to 6 % Hardness (Shore D): ~83 Thermal conductivity: 0.13 W/(m·K) Working temperature: up to 55 °C Moisture absorption: up to 0.4 % Color: various (depending on manufacturer) Key features: biodegradable, eco-friendly, easy to print, no heated bed required in most cases Applications: 3D printing, prototyping, packaging, household items	Equipment is necessary to implement the project	14500	8	116000		70/30%	В период поставки
АР26197931	Solar power station (Solar photovoltaic module)	Panel type: polycrystalline. Nominal power: not less than 300 W. Operating voltage (Vmp): not less than 36 V. Operating current (Imp): not less than 8.3 A. Open-circuit voltage: not less than 43 V. Short-circuit current: not less than 8.8 A. Dimensions: not less than 1640 × 992 × 40 mm. Weight: not less than 18 kg. Temperature coefficient: not less than −0.45 %/°C. Front surface material: not less than tempered glass. Resistance to hail and snow: not less than 5400 Pa pressure. Temperature range: not less than −40°C…+85°C. Service life: not less than 25 years.	Equipment is necessary to implement the project.	271130	2	542260		70/30%	В период поставки
АР26197931	Mounting Brackets for Solar Station	Thickness: 3–5 mm Material: aluminum or steel Mounting angles: 0–30° Protection: anti-corrosion (anodized or galvanized) Load capacity: 50–100 kg per panel Length: 50–200 mm (depending on panel) Bolts and nuts: M6–M8, stainless steel	Equipment is necessary to implement the project	12000	2	24000	-	70/30%	В период поставки
АР26197931	Voltmeter	Voltage range: not less than 70 V — up to 500 V Type: AC (single-phase) Display: electronic LED display Measurement accuracy: up to ±1 % Input resistance: not less than 1 MΩ Current consumption: up to 23 mA Update time: up to 300 ms Display color: red / blue / green Dimensions: up to 48 × 29 × 22 mm Mounting hole: up to 46 × 27 mm Weight: up to 18 g Operating temperature: not less than −20 °C and up to +65 °C	Equipment is necessary to implement the project	14200	1	14200	-	70/30%	В период поставки
АР26197931	Ammeter	Power supply: from mains, not less than 220 V Type: ammeter Device: electronic Functions: none PC connection: no Display: available Color: white, not less than 90% surface gloss	Equipment is necessary to implement the project.	5400	1	5400	-	70/30%	В период поставки
АР26197931	Circuit Breaker	Rated operational voltage – not less than 230 V Rated operational current (In) – not less than 10 A Number of poles – not less than 1 Rated network frequency – not less than 50/60 Hz Maximum breaking capacity – not less than 4.5 kA Current limiting class – not less than 3 Electrical endurance – not less than 6000 cycles Mechanical endurance – not less than 15000 cycles Operating temperature range – from −40°C not less than +50°C Storage temperature range – from −40°C not less than +70°C Terminal protection degree (per GOST 14254-96) – not less than IP20 Pollution degree (per GOST 9920-89) – not less than 2 Max cross-section of connecting conductor – not less than 16 mm² Thermal release characteristic – per GOST R 50345-99 Overall dimensions – not less than 9×73×80 mm Weight – not less than 52 g	Equipment is necessary to implement the project.	4624	2	9248	-	70/30%	В период поставки
АР26197931	Installation and mounting of the solar power station	Site preparation, assembly, and installation of the solar power station.	The service is required for the further implementation of the project.	180000	2	360000	-	70/30%	В период поставки
АР26197931	Monoblock	Acer Aspire C27-2G Monoblock, 27" FHD, Core i5-13420H/16GB/512GB/ UHD Graphics/W11SL	Equipment is necessary to implement the project	400000	9	3600000		50/50%	В период поставки
АР26197931	Laptop	MSI Katana 15 B14WFK, Core i7-14650HX/15.6"QHD/16GB/1TB/GF RTX5060 8GB/LAN/W11H	Equipment is necessary to implement the project.	860000	1	860000		50/50%	В период поставки
АР26197931	Laptop	Laptop 15.6" HP Victus Gaming 15-fb3077ci (Ryzen 7 7445H, 16GB RAM, 512GB SSD, RTX 4050 6GB, FreeDOS) (CW2U7EA)	The service is required for the further implementation of the project (Working with technical drawings and performing calculations).	841445	1	841445		100%	В период поставки

Барлығы: 27 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26101621	Ultrasound system with Doppler imaging	Ultrasound device with doppler, Draminski Blue (complete set with three sensors and additional software for the study of cattle, MRS, Pigs, Horses, small pets), Poland	Equipment is necessary to implement the project.	30000000	1	30000000		70/30%	В период поставки
AP26101621	Veterinary first-aid kit	45 L thermal case with surgical kit (vet option: with veterinary surgical kit)	Equipment is necessary to implement the project.	75000	4	300000	-	50/50%	Поставлено
AP26101621	ELISA kit for bovine LPS (lipopolysaccharide)	Bovine LPS (lipopolysaccharide) ELISA kit, 96 tests, ELK8425	Reactive is necessary to implement the project.	302741	10	3027410	-	50/50%	Поставлено
AP26101621	Monoblock	Acer Aspire C27-1 All-in-One, 27" FHD, Core i5-13420H / 8GB / 512GB / UHD Graphics / Windows 11 SL	Equipment is necessary to implement the project	400000	2	800000		50/50%	Поставлено
AP26101621	Office supplies	Pencil "CONTE" from China JeiLong (12) (72) - 10 pcs.45=450; A4 file KUVERT 50 microns (100) - 100 pcs.25=2500; Tape 48 mm100m transparent Scotch (6) (36) - 10 pcs.625=6250; Clip 32mm (DL0003) (12) (144) - 24 pcs.80=1920; Assorted CHINA paste 7676mm 100l V3 (12) - 5 pcs.280=1400; DELI STATIONERY KNIFE, 9MM, REINFORCED, RUBBERIZED PEN 044-2039 - 2 pcs.690=1380; Permanent marker OfficeSpace”"8004A”” black, bullet-shaped, 3mm 265705 (12) - 10 pcs.190=1900; Paper “SvetoCopy” A4 80 (500) - 15 pieces2450=36750	Stationery is necessary for the project to be implemented	54200	1	54200	-	100%	В период поставки
AP26101621	Supplies	Gloves veterinary. and/o with shoulder pad "BigSensetiv" (100pcs) pack - 112000=12000, Gloves veterinary. I/o "LIGHT" (100 pieces) 20mkm (pieces) - 28500=17000, nitrile gloves, non-sterile, powder-free, size M (Pair) - 23000=6000, nitrile gloves, non-sterile, powder-free, size L pairs - 43000=12000, Universal medium apron (pcs.) - 53500=17500, Working DIAGONAL bathrobe, men's (r-r52-54, 170-176cm) - 54200=21000, DISPOSABLE BATHROBE (pcs.) - 10650=6500, Esmarch mug (pcs.) - 51000=5000, one-time mask (pcs.) - 10*42.17=421.74	Supplies are necessary for the project implementation	97421	1	97421	-	100%	В период поставки

Барлығы: 6 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26100579	Monoblock	Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/8GB/512GB/UHD Graphics/W11SL	Equipment is necessary to implement the project.	400000	5	2000000	october	50/50	В период поставки
AP26100579	Refrigeration equipment	DEXP freezer cabinet F4-28AMA - 275 490 tg Refrigerator LG GC-B509MLWM - 351 490 tg	Equipment is necessary to implement the project.	626980	1	626980	-	50/50	В период поставки
AP26100579	SimpliAmp Amplifier	Thermal cycler for DNA amplification. Used in PCR studies.	Equipment is necessary to implement the project.	3990517	1	3990517	october	50/50	В период поставки
AP26100579	consumables for PCR research	Primer rDNA16S V1-V5 region, Bact-8F, AGAGTTTGATCCTGGCTCAG 2х14560=29120 Primer rDNA16S V1-V5 region, Bact-936R, 4 GTGCGGGCCCCCGTCAATTC 2х14560=29120 D-Cells kit for DNA extraction from animal and bacterial cells, 250 isolations 1х479941,28=479941,28 Agarose for electrophoresis (Low-BEO), 100 g 2х69328=138656 Immunological tablet, 96-well 20х1128,96=22579,20 MiniMed vacuum tube with K2-EDTA, 2ml, 100 pcs 10х11901,12=119011,20 Laboratory test tube 15 ml, conical 17*120 mm with screw eraser 3х50967,84=152903,52 Microcentrifuge tube 1.5 ml, graduated 500 pcs PCR Clean 3х7056=21168 Microcentrifuge tube 2.0 ml, graduated 500 pcs PCR Clean 1х7840=7840 Microcentrifuge tube 2.0 ml, graduated 500 pcs PCR Clean 3х10192=30576 bacteriological loop 1 µl with needle colorless (20 pcs/pack) 10х834,18=8341,76 bacteriological loop 10 µl with a colorless needle (20 pcs/pack) 15х834,18=12512,64 Tampon probe MiniMed sterile in a test tube pack of 100 pcs 5х13108,48=65542,40	To conduct research work	1117315	1	1117315	october	50/50	Поставлено
AP26100579	materials for microbiological research	Diachym is a Gram coloring kit : 310900=32700 Petri dishes with PS lid (90×15mm) glass: 1001400=140000 1ml tip, 500pcs package: 29000=18000 Tips 200mkl (1000pcs=1up): 29000=18000 Tip for dispenser 10ml IKA: 2*12000=24000	To conduct research work	232700	1	232700	october	50/50	Поставлено
AP26100579	Nutrient media	Triptic Soy Agar, 2х44500=89000 Triptic Soy Broth, 2х44500=89000 CHROMagar Enterobacter, 2х144000=288000 CHROMagar Staphylococcus, 2х161000=322000	To conduct research work	788000	1	788000	october	50/50	Поставлено
AP26100579	Samsung Odyssey G4 LS25BG400EIXCI 25 Full HD/IPS/1ms/240Hz Monitor	Screen size: 25″ (63.5 cm) Resolution: 1920×1080 (Full HD) Panel type: IPS Refresh rate: up to 240 Hz Response time: 1 ms (GtG) Brightness: 400 nits Features: AMD FreeSync Premium, NVIDIA G-Sync compatible Ports: DisplayPort 1.2, HDMI 2.0 Adjustments: height, tilt, swivel, VESA mount 100×100	Equipment is necessary to implement the project.	104990	1	104990	october	50/50	Поставлено
AP26100579	Indesit DS 4200W Refrigerator	Refrigerator for storing biological reagents and samples.	Equipment is necessary to implement the project.	189990	1	189990	october	50/50	Поставлено
AP26100579	CHROM agar Orientation	A chromogenic medium designed for isolation and presumptive identification of microorganisms from clinical samples. Different bacteria produce colonies in distinct colors, enabling rapid and accurate differentiation.	To conduct research work	281505	1	281505	-	50/50	В период поставки
AP26100579	Master Mix Red Taq DNA Polymerase 2X, 1,5 мМ MgCl₂, 500 тестов, Avantor	A ready-to-use mixture for DNA amplification. Contains 1.5 mM MgCl₂ and Taq polymerase. Suitable for 500 tests. Provides convenience and consistent, reliable results.	To conduct research work	171160	1	171160	-	50/50	В период поставки
AP26100579	Veterinary medical consumables	Forceps for dressing 10x2900=29000 Surgical scissors 10x2500=25000 First aid kit 1x14452=14452 Sterile gloves 2x2500=5000 Sterile disposable scalpel 100x1500=150000 Safety glasses closed 10x1250=12500 Filter paper 100×100cm 3x5200=15600 Disposable three-layer mask 100x45=4500 Alcohol, 96% 5x3000=15000 Polyester bags for honey. Waste, class A 4x1500=6000	To conduct research work	277052	1	277052	-	50/50	В период поставки
AP26100579	consumables for PCR research	Adhesive coating for 96-well plates 100 pcs/pack - 78 881 tg PCR tablets, 96 wells, without stability skirt, colorless, 25 pcs/pack - 75 669 tenge TAE Buffer (Tris-Acetate EDTA) (50X), 1 l. - 65 351 tenge Water without nucleases, 30 ml. - 25 311 tg PCR master mix (2X), 200 reak. - 74 591 tg DNA loading dye in gel (6X), 5 x 1.0 ml. - 38 269 tg DNA Marker GeneRuler 1 kb, 5x50 micrograms. - 93 198 тг	To conduct research work	451270	1	451270	-	50/50	В период поставки
AP26100579	materials for microbiological research	Conical flask KN-2-250-34 TS with graduation, GOST 25336-82 — 5 pcs — 7,500.00 KZT Nitrile non-sterile gloves (100 pcs) — 2 packs — 7,000.00 KZT Laboratory filter paper F, GOST 12026-76 — 3 kg — 15,000.00 KZT Disposable face mask — 100 pcs — 5,000.00 KZT Antiseptic — 10 L — 35,000.00 KZT Centrifuge tube 15 mL — 100 pcs — 20,000.00 KZT Microcentrifuge tube 2 mL (500 pcs per pack) — 1 pack — 17,500.00 KZT Beaker B-1-800 with graduation — 5 pcs — 13,000.00 KZT Alcohol burner SL-2 — 5 pcs — 40,000.00 KZT Medical lab coat — 50 pcs — 50,000.00 KZT Protective suit — 1 pc — 44,980.00 KZT Conical flask KN-2-5000-50 TS with graduation, GOST 25336-82 — 2 pcs — 24,000.00 KZT Conical flask KN-2-1000-50 (32/34) — 2 pcs — 10,000.00 KZT Swabs — 50 pcs — 10,000.00 KZT	To conduct research work	298980	1	298980	-	50/50	В период поставки
AP26100579	Veterinary medical consumables	Conical flask KN-2-250-34 TS with a scale GOST 25336-82 2x1500=3000 Antiseptic 5x3500=17500 Tuppers 50x205=10265.38	To conduct research work	30765	1	30765	-	100	В период поставки

Барлығы: 14 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP19680272	LED screen	Led screen 1860x3300 cm with a resolution of P 2.5 With an acoustic system	Purchase of LED screen for use in conducting a special course developed on the basis of a scientific project and presentation of the project results.	3285388	1	3285388	-	50/50%	В период поставки
AP19680272	Publishing books	Publication of a Book Series 1. Publication of an Anthological Collection: volume — 800–950 pages, bound. Print run — 300 copies. Hard cover, white paper. 2. Publication of a Linguistic Dictionary: volume — 180–300 pages, bound. Print run — 100 copies. Hard cover, white paper. 3. Publication of a Monograph: volume — 140–200 pages, bound. Print run — 100 copies. Hard cover, white paper.	Summarizing the results of the project research and publishing scientific products according to the schedule.	1600000	1	1600000	-	50/50%	Поставлено
AP19680272	Purchase of office supplies	Purchase of office supplies	The goods are necessary for the implementation of the project	56098	1	56098		100%	В период поставки
AP19680272	Pen	Ballpoint pen - 1 piece	To provide an experiment.	90	1	90		100%	В период поставки

Барлығы: 4 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР19680032	Purchasing an interactive panel	nteractive panel MARTITOUCH 75 dm Negyzgi sipattamalary: Android 14 // core processor Jads: 8 Gb LPDDR 4x / 128 Gb Standards: 4K/Ultra HD (3840*2160) Number of tigizu sanas – 50 Zhauap take ukyty – 2.5 milliseconds Koru Buryshy – 178° Contrast sheets – 5000:1 Zhanartu zhiіligi – 60 Hz Zharkyndygy – 400 OPS kosymsha computer ornatuga arnalgan slot Interface: HDMI, USB 2.0, USB 3.0, USBTouch, RJ45, VGA, EARPHON Regarding our computer: Bluetooth 5.0, WiFi 2.4–5 GHz High quality 13 megapixel camera, built-in microphone, speaker. Key features: Screen-mounted, vandalized, toaded, Acoustic, powered – 48 W Zhiyntyk kuramynda: 2 marker, Kashyktan baskar remote control, kuat cables, Vesa bekitkishi (1 dan) Capildik merzimi: 12th OPS i5 8/256 Mobildi terek	Purchase of interactive panels for use in conducting a special course developed on the basis of a scientific project and presentation of the project results	1251445	2	2502890		50/50%	В период поставки
АР19680032	Publishing a monograph	Topic: “Structural-semantic and linguacultural aspects of the vocabulary of social networks” Volume: 140 pages ISBN included.	Summarize the results of the project research and publish the monograph “Structural-semantic and linguacultural aspects of the vocabulary of social networks” in accordance with the calendar plan.	3250	500	1625000	-	50/50%	В период поставки

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP26198315	Species-level identification of 3 (three) strains of probiotic microorganisms	Identification of strains based on the proteomic profile of ribosomal proteins using MALDI Biotyper technology and by sequencing a fragment of the conserved 16S rRNA locus	Species-level identification of probiotic microorganism strains is necessary to confirm their taxonomic affiliation and biological safety, as well as to select the optimal strains for the development of postbiotic-containing dietary supplements.	330000	1	330000	February	100%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP27508635	Steaks	steaks from angus	consumable material	25500	50	1275000	-	50/50%	В период поставки
AP27508635	Steaks	steaks from Kazakh white-headed bulls	сonsumable material, расходный материал	9000	50	450000	-	50/50%	В период поставки
AP27508635	Refrigerated display case	Refrigerated display, Length, mm:3750 Width, mm:1145 Height, mm:1485 Type:open Voltage:220 V Temperature range:-5...+5°C Cooling type:dynamic Refrigerant:R404A Current frequency:50 Hz	Equipment is necessary to implement the project.	660000	2	1320000	-	50/50%	В период поставки
AP27508635	MiniScan EZ 4500L: Portable spectrophotometer	The MiniScan EZ 4500L is a portable spectrophotometer from HunterLab designed to accurately measure the reflected color of various samples. The 45°/0° geometry device (45° lighting, 0° surveillance) is ideal for quality control in production, providing reliable and reproducible results. The lightweight, ergonomic design allows you to operate the device with one hand, while the large, easy-to-read display and intuitive thumb navigation simplify work on production lines, warehouses or laboratories. The firmware includes basic industrial color scales and indexes, making the MiniScan EZ 4500L a universal solution for evaluating the color of fabrics, paper, powders, granules, and even liquids (when using a cuvette). The rugged design and AA batteries ensure mobility and long-term autonomy.	Equipment is necessary to implement the project.	7995738	1	7995738		50/50%	В период поставки
AP27508635	Antimicrobial discs	sterile discs used to test microorganisms' sensitivity to antibiotics.	Equipment is necessary to implement the project.	3614	173	625222		50/50%	В период поставки
AP27508635	Mueller Hinton Agar	Standard growth medium for testing bacterial susceptibility to antibiotics.	Equipment is necessary to implement the project.	30300	1	30300	-	50/50	В период поставки
AP27508635	Buffered Peptone Water	Buffered Peptone Water is a liquid medium used for the pre-enrichment of microorganisms. It supports the survival of bacteria after stress conditions and promotes the recovery of pathogens, particularly Salmonella, prior to detection	Research within the project	37500	2	75000	-	50/50%	В период поставки
AP27508635	Gram Coloring Kit	Volume: 0.2 L Color: blue, light blue, black Contents: gentian violet (100 ml), Lugol’s solution (100 ml) Цвет: синий, голубой, черный Состав: генциан-виолет (100 мл), раствор Люголя (100 мл) Volume: 0.2 L Color: blue, light blue, black Contents: gentian violet (100 ml), Lugol’s solution (100 ml)	Research within the project	11750	2	23500	-	50/50	В период поставки
AP27508635	tip	1 ml (1000 µl) tip – transparent, PP material, autoclavable, 1000 pcs/package.	Research within the project	25950	2	51900	-	50/50%	В период поставки
AP27508635	tip	Tips 200 µl – transparent, PP, autoclavable, 1000 pcs = 1 pack.	Research within the project	24500	1	24500		50/50%	В период поставки
AP27508635	ChroMed E.coli агар, ChroMed E.coli агар, ChroMed E.coli Agar	ChroMed E.coli Agar, уп/100г , ChroMed E.coli Agar, pack/100g, ChroMed E.coli Agar уп/100г ,	Research within the project	42500	1	42500	-	50/50%	В период поставки
AP27508635	Soy-casein Agar	Packaging type: polyethylene jar Unit of measurement: pack Pack size: 500 g	Research within the project	23000	1	23000	-	50/50%	В период поставки
AP27508635	Light glass reaction jar with a blue screw-on plastic lid and 500 ml markings	Material: glass Type: Light glass reagent jar with blue screw-on plastic cap 500 ml with divisions Capacity 500 ml	Research within the project	3000	20	60000	-	50/50	В период поставки
AP27508635	Steaks	steaks from angus	consumable material	25500	50	1275000	December	50/50	В период поставки
AP27508635	Steaks	steaks from Kazakh white-headed bulls	consumable material	9000	50	450000	December	50/50	В период поставки
AP27508635	Shaker	Shaker SK-0330-M A laboratory shaker for uniform mixing and incubation of samples in flasks/tubes with adjustable shaking speed.	Equipment is necessary to implement the project.	355000	1	355000	December	50/50	В период поставки
AP27508635	Вортекс	A vortex mixer for rapid, vigorous mixing of tube contents via circular vibrations.	Equipment is necessary to implement the project.	210000	1	210000	December	50/50	В период поставки
AP27508635	Monitor	A monitor is a display device used to present visual information. It features high resolution, wide viewing angles, and fast response time. Suitable for office tasks, gaming, and graphic design.	Equipment is necessary to implement the project.	104990	1	104990	December	50/50	В период поставки
AP27508635	Refrigerator	A refrigerator is a household appliance designed for cooling and long-term food storage. It features low energy consumption, spacious compartments, and precise temperature control.	Equipment is necessary to implement the project.	219010	1	219010	December	50/50	В период поставки
AP27508635	Mechanical Pipettes	Manual micropipettes for accurate dispensing of small liquid volumes, ensuring precision and repeatability.	Equipment is necessary to implement the project.	148000	1	148000	December	50/50	В период поставки
AP27508635	Water Bath	Temperature-controlled water bath for uniform heating and maintaining set temperatures of samples.	Equipment is necessary to implement the project.	520500	1	520500	December	50/50	В период поставки
AP27508635	Electronic Balance	Electronic laboratory balance for precise weighing of reagents and samples, suitable for analytical tasks.	Equipment is necessary to implement the project.	250000	1	250000	December	50/50	В период поставки
AP27508635	Laboratory Hot Plate	Electronic laboratory balance for precise weighing of reagents and samples, suitable for analytical tasks.	Equipment is necessary to implement the project.	315000	1	315000	December	50/50	В период поставки
AP27508635	Laminar flow cabinet	A laminar flow cabinet with HEPA filtration provides a sterile airflow for safe handling of cultures and reagents, preventing sample contamination.	Equipment is necessary to implement the project.	2700463	1	2700463	December	50/50	В период поставки
AP27508635	Conical (Erlenmeyer) flask with graduation	Conical laboratory flask (Erlenmeyer type) with a nominal volume of 1000 mL and an approximate graduation scale. The mark KN-3 denotes the flask type/version, while “34” refers to the neck/joint size for compatible stoppers or attachments. Designed for preparing, mixing and heating solutions, carrying out reactions, and titration work. The conical shape helps reduce splashing during swirling and provides stable handling. Typically made of heat-resistant, chemically durable laboratory glass.	For conducting laboratory experiments.	4000	5	20000		100%	В период поставки
AP27508635	Tube	A 5 mL laboratory test tube intended for handling small liquid volumes: sampling and storage, qualitative reactions, and solution dilutions. Depending on the model, it may have a round or conical bottom. Typically manufactured from chemically resistant glass; glass tubes can be gently heated in a water bath or over low flame when proper safety procedures are followed.	For conducting laboratory experiments	69.71	200	13942		100%	В период поставки
AP27508635	V-1-50 graduated beaker	The V-1-50 graduated beaker is a laboratory measuring container with a 50 ml capacity. It features a clear graduated scale for accurate volume measurement. The beaker is commonly used in chemical and biological laboratories, medical practice, and educational institutions for measuring, pouring, and mixing liquids. It is usually made of chemically and thermally resistant glass.	For conducting laboratory experiments.	1094	1	1094		100	В период поставки

Барлығы: 27 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP19178097	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Required for data analysis and systematic text work.	400000	2	800000	September	50/50%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP25796077	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Required for data analysis and systematic text work.	399990	2	799980	September	50/50%	В период поставки
AP25796077	Infographic map	Format: Digital (PDF, PNG, SVG) and print version Size: A5 or B5 standards Content layers: historical data, chronological scale, legend symbols Graphic elements: charts, pictograms, map signs Visualization tools: Adobe Illustrator, CorelDRAW, Canva, or ArcGIS StoryMaps Color: full color (CMYK for print, RGB for digital), soft palette comfortable for viewing Design style: minimalist, focused on clear data presentation, with preserved contrast Fonts: suitable Cyrillic and Latin fonts for academic text (Arial, Times New Roman, Open Sans) Paper quality (for print): density 130–170 g/m², matte or glossy finish	It makes it possible to present research findings visually and convey the data clearly.	1	1	1	September	50/50%	В период поставки

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР25796807	Laptop Lenovo Yoga Pro 7 14IMH9	Operating System: Windows 11 Home (x64) SL Processor: Intel Core Ultra 5 Processor Model: 125H Processor Frequency, GHz: 1.2 Integrated Processor Graphics: Intel Arc Graphics RAM Capacity, GB: 32 RAM Configuration: 32 GB (soldered on the motherboard) Number of RAM Slots: None Solid State Drive: 1 TB SSD Screen Size, inches: 14.5 Screen Resolution: 3072 x 1920	Purchase of a laptop for the material and technical base.	743386	1	743386	2025	50/50%	В период поставки
АР25796807	Costs of work performed by outside organizations	Publication of an article in journals recommended by the Science and Higher Education Quality Assurance Committee of the Ministry of Science and Higher Education of the Republic of Kazakhstan	For the publication of a scientific research article within the framework of the project	56064	1	56064	2025	50/50%	В период поставки
АР25796807	Scientific research service	Testing samples using the PCR method	PCR testing of samples collected within the framework of the project.	9843	150	1476450	September	100	В период поставки
АР25796807	Reagents and consumables for PCR analysis	1. Taq DNA Polymerase, with standard Taq buffer, without magnesium, 5000 U/ml, 400 U, New England Biolabs, M0320S – 2 packs 2. dNTP Mix, 10 mM, 8 μM, 4×0.2 ml, New England Biolabs, N0447S – 2 packs 3. RIBO-prep Kit, Form 2, AmpliSens, K2-9-Et-100 – 2 kits 4. Microcentrifuge tubes, 1.5 ml, clear, DNase/RNase-free, non-sterile, 5000 pcs/pack, Biologix, 80-1500 – 2 packs 5. Axygen PCR tubes, 0.2 ml, thin-walled, flat cap, clear, non-sterile, 1000 pcs/pack, Corning, PCR-02-C – 2 packs 6. Filter tips, 10 µl, in racks, sterile, DNase/RNase and pyrogen-free, length 46 mm, 96 tips/rack, 960 pcs/pack, Biologix, 23-0010S – 2 packs 7. Axygen® universal filter tips, 200 µl, clear, in racks of 96 tips, 960 pcs/pack, Axygen, TF-200-R-S – 2 packs 8. (1-Hexadecyl)trimethylammonium bromide (CTAB), 100 g, Glentham Life Sciences, GD0341-100g – 3 packs 9. Filter tips, 1000 µl, in racks, sterile, DNase/RNase and pyrogen-free, length 102 mm, 96 tips/rack, 50 racks/pack, Biologix, 23-1000S – 1 pack	Research within the project	1223912	1	1223912		100%	В период поставки

Барлығы: 4 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP25796649	Scientific research service	Laboratory services for the determination of organoleptic, physico-chemical, biochemical, microbiological parameters, heavy metals and minerals.	To provide an experiment.	800	1	800	2025	50/50%	В период поставки
AP25796649	Procurement of materials, equipment, and/or software	Milk	To provide an experiment.	500	200	100000	-	100%	В период поставки
AP25796649	Procurement of materials, equipment, and/or software	Buttermilk	To provide an experiment	350	200	70000	-	100%	В период поставки
AP25796649	Procurement of materials, equipment, and/or software	Dry serum	To provide an experiment.	800	50	40000	-	100%	В период поставки
AP25796649	Procurement of materials, equipment, and/or software	Horse fat	To provide an experiment.	2500	20	50000	-	100%	В период поставки
AP25796649	Procurement of materials, equipment, and/or software	Sea salt	To provide an experiment.	550	5	2750	-	100%	В период поставки
AP25796649	Procurement of materials, equipment, and/or software	The Lactane 1-4 М milk analyzer measures all indicators of milk in 1 minute, thereby detecting falsification and compliance with established price categories. To accurately calculate the result, you need to know how much fat, protein, SOMO, what is the density of milk, how much water is in it, and determine the freezing point. You can analyze not only the milk of cows, but also other animals: goats, buffaloes, sheep.	Equipment is necessary to implement the project.	500000	1	500000	-	100%	В период поставки
AP25796649	Scientific research service	Laboratory services for the determination of fatty acid composition and physicochemical parameters	Research within the project	108900	1	108900	-	100%	В период поставки
AP25796649	Laptop	Lenovo ThinkBook 16 G8 IRL Laptop, Core i5-13420H/16"WUXGA/16GB/512GB/UHD Graphics/LAN/W11H	Purchase of a laptop for the material and technical base.	510000	1	510000		100%	В период поставки
AP25796649	Purchase of materials	A4 paper-8 pack The registrar folder-5 pieces File folder-3 pieces	The materials are necessary for the implementation of the project.	28173	1	28173		100%	В период поставки

Барлығы: 10 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР23489475	hard drive	External hard drive Transcend, StoreJet 25H3 1TB HDD USB 1 TB TS1TSJ25H3P, USB3.0, ext., power via USB	The project requires an external hard drive for reliable storage and backup of large amounts of data, including 3D models, photo/video materials, and research archives. The device will ensure the security of information and the convenience of working with data in field and office conditions.	44	1	44	2025	50/50%	В период поставки
АР23489475	Backpack	MarketOnline 504Blue trekking Backpack 50 L blue	Field work requires a trekking backpack adapted for long-term expeditions and carrying heavy equipment. It will provide comfort, even load distribution and protection of the contents in difficult natural conditions.	17	1	17	2025	50/50%	В период поставки
АР23489475	Шпатель / Шпатель / spatula	Archaeological excavations require a specialized trowel designed for precise stripping of the cultural layer and processing of small details. The use of the tool will ensure the accuracy of the work, the safety of the finds and the high accuracy of research in the field.	Archaeological excavations require a specialized trowel designed for precise stripping of the cultural layer and processing of small details. The use of the tool will ensure the accuracy of the work, the safety of the finds and the high accuracy of research in the field.	6	1	6	2025	50/50%	В период поставки
АР23489475	Sleeping bag	Fleece sleeping bag-liner single tourist	Archaeological expeditions require a sleeping bag to keep participants working, regardless of weather conditions and temperature.	5	1	5	2025	50/50%	В период поставки
АР23489475	Tent	High Peak Minilite 2 Tent blue	a tent for ensuring the protection of field workers from adverse weather conditions and the convenience of living in the field	25	1	25	2025	50/50%	В период поставки
АР23489475	Gloves	work gloves	Archaeological work requires protective gloves, which will ensure the safety of hands when working with tools, finds and soil. They will help to avoid injury, contamination and provide convenience in the field.	72	1	72	2025	50/50%	В период поставки
АР23489475	Bayonet shovel	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	3	1	3	2025	50/50%	В период поставки
АР23489475	Shovel	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	3	1	3	2025	50/50%	В период поставки

Барлығы: 8 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР2З484846	Laboratory research	Determination of amino acid composition (arginine, lysine, tyrosine, phenylalanine, histidine, leucine + isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine) by capillary electrophoresis Determination of fatty acid composition by GLC Determination of the mass fraction of fiber Determination of the amount of vitamins E (α, β, γ, δ) by HPLC Determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc) by capillary electrophoresis Determination of the amount of β - carotene Determination of fat-soluble antioxidants Determination of water-soluble antioxidants Determination of iron Determination of zinc Determination of magnesium Determination of calcium Determination of phosphorus Determination of iodine in 1 sample	Required for the completion of the research project	168300	1	168300	june	50/50%	В период поставки
АР2З484846		Horse meat-20 kg * 3700 = 74000 tenge turkey meat-5 kg2400 = 12000 tenge chicken fillet-5 kg2000 = 10000 tenge beef - 120 kg * 4000 tenge = 480000 tenge Lamb - 20 kg * 3700 = 74000 tenge tail fat - 10 kg * 4000 = 40000 tenge green buckwheat - 10 kg * 1200 tenge= 12000 tenge wheat flour 10 kg * 360 tenge = 3600 tenge	Conducting laboratory work in accordance with the calendar plan	705600	1	705600	november	100%	Поставлено
АР2З484846	Raw materials and supplies	Horse meat – 20 kg × 3700 KZT = 74,000 KZT Chicken meat – 5 kg × 2000 KZT = 10,000 KZT Beef – 30 kg × 4000 KZT = 120,000 KZT Lamb – 20 kg × 3700 KZT = 74,000 KZT Lamb fat (tail fat) – 10 kg × 4000 KZT = 40,000 KZT Wheat flour – 50 kg × 360 KZT = 18,000 KZT Packaging materials (vacuum bags, food films) – 200 pieces × 800 KZT = 160,000 KZT Production knives – 5 pieces × 40,000 KZT = 200,000 KZT Cutting boards – 10 pieces × 10,000 KZT = 100,000 KZT Disposable gowns – 200 pieces × 500 KZT = 100,000 KZT Disposable gloves – 17 packs × 5,257 KZT = 89,369 KZT Caps (head covers) – 200 pieces × 150 KZT = 30,000 KZT Plastic containers – 50 pieces × 1,265 KZT = 63,250 KZT	Conducting laboratory work in accordance with the calendar plan	1078619	1	1078619		100%	В период поставки

Барлығы: 3 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992981	Services for rent	Housing rental services for field expeditions	Necessary to perform calendar tasks of the Program	2624000	1	2624000	may	50/50%	В период поставки
BR24992981	Scientific research service	Training course on the use of geoinformation system ESRI ArcGIS	The service is necessary for the implementation of the Program.	842800	1	842800	may	50/50%	В период поставки
BR24992981	Scientific research service	Conducting a sociological study of the current state of recreational tourism in Kazakhstan, including the Alakol region, and its importance, as well as general tourism services and their quality. Conducting sociological research on the effective use of the balneological resources of the Barlyk-Arasan resort and the state of resort medicine	This service is necessary to perform calendar tasks of the Program	12000000	1	12000000	july	50/50%	В период поставки
BR24992981	Providing servicese	Chemical, biochemical, microbiological analysis of the composition of mineral waters and medicinal mud of the Alakol basin	Necessary to perform calendar tasks of the Program	1736000	1	1736000	-	50/50%	В период поставки
BR24992981	Translation services	The services include: translation of scientific texts from Kazakh and/or Russian into English in compliance with the norms of academic writing.; scientific text editing with a reconciliation of terminology, presentation logic and stylistics; proofreading of translated and edited texts (spelling, grammar, punctuation); bringing the text in line with the requirements of international peer-reviewed scientific journals. The volume of services is 168 pages of typewritten text.	Translation of scientific articles developed as a result of the research from Kazakh/Russian into English in an academic style and scientific editing, editing, correctional services	840000	1	840000		100%	В период поставки

Барлығы: 5 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP19579443	Спектрофотометр СФ-2000	The spectrophotometer is designed to measure the spectral coefficients of directional transmission of liquid and solid transparent samples. The detectors are CCD rulers with high sensitivity and resolution parameters. The high-speed USB communication interface with the computer provides fast bidirectional data exchange with the computer, increasing operator comfort.	The device is necessary for conducting research to determine the ratios of polymers in the initial mixture to be applied to the soil.	3591800	1	3591800	Май-декабрь	30/70%	Поставлено
AP19579443	Стимулятор роста растений	YaraVita BioNUE™ Plant Growth Stimulation Solution	It is necessary for conducting pilot tests of the technology.	264000	1	264000	Май-июнь	100%	Поставлено
AP19579443	Стимулирующий раствор для роста растений	Plant Growth Stimulation Solution TRAINER"	It is necessary for conducting pilot tests of the technology."	200550	1	200550	Май-июнь	100%	Поставлено
AP19579443		Nitroammophoska. Complex fertilizers for plant growth and development	It is necessary for conducting pilot tests of the technology.	12250	1	12250	Май-июнь	100%	Поставлено
AP19579443	Удобрение	YaraTera KRISTALON 12-12-36 RED	It is necessary for conducting pilot tests of the technology.	124875	1	124875	Май-июнь	100%	Поставлено
AP19579443	Удобрение	Ammonium nitrate	It is necessary for conducting pilot tests of the technology.	27750	1	27750	Май-июнь	100%	Поставлено
AP19579443	Monoblock Acer Aspire 27"	Моноблок Acer Aspire C27-2G (Black)/ Intel Core i5 13420h/ 32 ГБ DDR4 3200/ 512 ГБ M.2 NVME SSD/ 27"FullHD IPS non-touch/ 802.11axWiFi6+BT5.0/ беспроводные Kb+M/ Windows 11 + Office LTSC Standard 2024	Purchase of a monoblock for the material and technical base	500000	3	1500000	September	50/50%	В период поставки
AP19579443	3.0 kW heating element	spare part for the Livam AE-4 distiller	To prepare water for work	42237	2	84474	September	100	В период поставки
AP19579443	ADS Multi Acid Decomposition System	The system is designed for sample preparation of samples for elemental analysis: the material of the heating unit is graphite with Teflon coating, The number of tubes to be installed in one heating unit is 16 for 100 ml and 9 for 50 ml. Heating temperature - 250 C, The power is not more than 3.2 kW.	The device is necessary to prepare soil samples for chemical analysis.	3000000	1	3000000	-	50/50%	В период поставки

Барлығы: 9 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992916	High cross-country ability in off-road conditions, large capacity). The Stone Age Study Group.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity)	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	В период поставки
BR24992916	motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Early iron age	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Monument vault squad.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	2000000	1	2000000	may december	70/30%	Поставлено
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). A group for the study of Early Iron Age settlements.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1400000	1	1400000	may-december	70/30%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). The group for the study of burial mounds of the elite of the Early Iron Age.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1400000	1	1400000	may-december	70/30%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Ethno-archaeological group.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity).Exploration Squad (Medieval times)	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1000000	1	1000000	may-december	70/30%	В период поставки
BR24992916	Monograph by Samashev Z.""The visual activity of the ancient population of the Kazakh	Technical specifications of the publication: Format: 84 × 108 1/16 Volume: 300 pages Block printing: full color (4+4 cr.) Block paper: coated, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Binding design: one-sided printing (4+0 gr.), lamination, foil stamping Coated paper, density 150 g/m2 Circulation: 300 copies	The publication of the monograph of the Doctor of Historical Sciences, Professor Zainolla Samashev "The visual activity of the ancient population of the Kazakh Altai" is a significant contribution to the development of national and world archaeological science. The work is based on many years of archaeological research conducted in the region of Eastern Kazakhstan, rich in unique rock art monuments.	3491100	1	3491100	may-december	50/50%	В период поставки
BR24992916	Monograph by Oshanov O. "Kazakh agricultural calendar".	Technical specifications of the publication Monograph: Oshanov O. ""Kazaktyn sharuashylyk kuntizbesi"" Format: 84 × 108 1/16 Volume: 380 pages Block printing: full-color, 4+4 colors Block paper: coated, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Binding design: 4+0 cu., lamination, foil stamping Coated paper, density 150 g/m2 Circulation: 300 copies	O. Oshanov's monograph "Kazaktyn sharuashylyk kuntizbesi" is devoted to a little-studied but extremely important aspect of the traditional culture of the Kazakh people - the system of economic and calendar knowledge. It explores the historical and ethnographic basis of the national calendar, its connection with the cycles of nomadic economy, natural rhythms and rituals reflecting the way of life of Kazakhs for centuries.	3870000	1	3870000	may-december	50/50%	В период поставки
BR24992916	Catalogue of archaeological collections of Kazakhstan. According to the collections of the regional museum.	Technical specifications of the publication Publication: Catalogue of archaeological collections of Kazakhstan. According to the collections of the regional museum Format: 70 × 100 1/8 (book) — 24.5 × 29 cm (height) Volume: 416 pages Block printing: full color (4+4 colors) Coated paper, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Decoration: 4+0 gr., lamination, foil stamping Binding paper: coated, density 150 g/m2 Circulation: 300 copies	The publication of the Catalog of Archaeological Collections of Kazakhstan is a fundamental scientific reference work, including a systematic description of artifacts stored in the collections of the museum of the Abai region. The catalog provides an opportunity for a comprehensive analysis and study of archaeological finds reflecting various stages of historical development in Kazakhstan.	4257000	1	4257000	may-december	50/50%	В период поставки
BR24992916	Earthworks. Medieval Monuments Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Medieval monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the medieval period on the territory of Kazakhstan, namely the Abai region.	4500000	1	4500000	may-december	70/30%	В период поставки
BR24992916	Earthworks. The Early Iron Age Study Group.	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 22 people. Duration of work: 35 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the detachment for the study of monuments of the Early Iron Age is an integral part of archaeological field research aimed at studying the material heritage of the Early Iron Age on the territory of Kazakhstan, namely the Abai region.	11550000	1	11550000	may-december	70/30%	В период поставки
BR24992916	Excavation team for the study of the Early Iron Age.	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 22 people. Duration of work: 35 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the detachment for the study of monuments of the Early Iron Age is an integral part of archaeological field research aimed at studying the material heritage of the Early Iron Age on the territory of Kazakhstan, namely the Abai region.	11550000	1	11550000	may-december	70/30%	В период поставки
BR24992916	Earthworks. Early iron age Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region.	4500000	1	4500000	june-december	70/30%	В период поставки
BR24992916	Earthworks. The Bronze Age Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region.	4500000	1	4500000	июнь-декабрь	70/30%	В период поставки
BR24992916	Earthworks. The Bronze Age Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region.	4500000	1	4500000	june-december	70/30%	В период поставки
BR24992916	Earthworks. The Stone Age Study Group	Type of work: Land work (archaeological excavation work).Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Stone Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Stone Age on the territory of Kazakhstan, namely the Abai region.	4500000	1	4500000	июнь-декабрь	70/30%	В период поставки
BR24992916	Primary conservation and restoration of discovered finds.	Primary conservation and restoration of discovered archaeological finds. Types of processed materials: Metals (bronze, iron, copper, silver, gold), Ceramics (ceramic vessels, fragments, fragments), Stone (ornamented or worked stones), Organic materials (bone, wood, leather, textiles, plants), glass, etc. The result of the work: Preservation of the historical value of the finds, Preparation of objects for further scientific research, Preparation for an exhibition or transfer to museum collections, a scientific report describing the condition of objects, restoration methods and condition after work, etc.	Primary conservation and restoration are an integral stage of archaeological research and include: Stabilization of the state of finds to prevent destruction; Mechanical and chemical cleaning of impurities and salts; Fixing and strengthening fragments, including joining crumbled objects; Preparation of objects for further storage, research and museum exposition. Without timely primary processing, many objects lose their scientific value and may be lost.	1067529	1	1067529	июнь-декабрь	100%	В период поставки
BR24992916	Radiocarbon analysis To obtain the absolute age of the monument (bone, collagen).	Radiocarbon dating: obtaining the absolute age of the monument (bone, collagen). Type of samples: Human or animal bones. Analysis results: The absolute date of the object or layer in calibrated years, taking into account the error. An indication of potential limitations related to calibration or the condition of the sample. A scientific report with photofixation, graphs and tables, as well as possible conclusions based on the dating results. The result of the work: Obtaining accurate dating (in calendar years) for archaeological sites, burials or objects. Using radiocarbon dating to synchronize with other dating methods and analyze cultural layers.	Radiocarbon dating (14C) is one of the most accurate and widely used methods for obtaining an absolute chronology of archaeological sites. In the case of animal or human bone analysis, the main source for dating is collagen, an organic protein that is resistant to postdepositional changes with good preservation. Conducting a 14C analysis allows you to: Establish the absolute age of an archaeological site or cultural layer; Link certain finds to a specific historical period; Clarify the chronological framework of the monument's existence, building stages, burials, etc.; Use the data in a comparative analysis with other monuments in the region. The results of radiocarbon dating are an important part of scientific interpretation and are mandatory in preparation for publications and museum catalogues.	221428	12	2657136	июнь-декабрь	100%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Bronze Age Monument Exploration Squad.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	400000	1	400000	november-december	70/30%	В период поставки
BR24992916	Radiocarbon analysis To obtain the absolute age of the monument (bone, collagen).	Radiocarbon dating: obtaining the absolute age of the monument (bone, collagen). Type of samples: Human or animal bones. Analysis results: The absolute date of the object or layer in calibrated years, taking into account the error. An indication of potential limitations related to calibration or the condition of the sample. A scientific report with photofixation, graphs and tables, as well as possible conclusions based on the dating results. The result of the work: Obtaining accurate dating (in calendar years) for archaeological sites, burials or objects. Using radiocarbon dating to synchronize with other dating methods and analyze cultural layers.	Radiocarbon dating (14C) is one of the most accurate and widely used methods for obtaining an absolute chronology of archaeological sites. In the case of animal or human bone analysis, the main source for dating is collagen, an organic protein that is resistant to postdepositional changes with good preservation. Conducting a 14C analysis allows you to: Establish the absolute age of an archaeological site or cultural layer; Link certain finds to a specific historical period; Clarify the chronological framework of the monument's existence, building stages, burials, etc.; Use the data in a comparative analysis with other monuments in the region. The results of radiocarbon dating are an important part of scientific interpretation and are mandatory in preparation for publications and museum catalogues.	1649753	1	1649753	november-december	100%	В период поставки
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Exploration Team of the Medieval Period of Eastern Saryarka.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1360000	1	1360000	ноябрь-декабрь	70/30%	В период поставки
BR24992916	Metallographic analysis of finds	Metallographic analysis is a method of studying materials aimed at revealing their internal structure. It provides insight into the structure, properties, and formation characteristics of a material, making it an important tool for studying archaeological finds.	Metallographic analysis is essential for obtaining objective information about the internal structure of the material being studied. This method allows us to identify the characteristics of its formation and state, which is essential for the accurate interpretation of the study results and subsequent conclusions.	2100417	1	2100417		100	В период поставки
BR24992916	Том 1, том 2. Bakhyt Nedelkhan. Kazakh-Qing relations in the era of abylaykhan. Volume 1, volume 2.	Bakhyt Khanuli. Abylaykhan dauirindegi Kazak-Qin karym-katynastary. Volume 1: The format is 84x108 1/16 Volume: 392str. v1+1cr. + 8str. b4+4cr., coated paper 90gr. The flyleaf is clean, the offset paper is 160g. Binding No. 4 – b4+0cr.+ lamination + embossing (foil), coated paper 150 gr. The edition is 500 copies. Bakhyt Khanuli. Abylaykhan dauirindegi Kazak-Qin karym-katynastary. Volume 2: The format is 84x108 1/16 Volume: 424str. v1+1cr. + 24 pages. b4+4 pages., coated paper 90g. The flyleaf is clean, the offset paper is 160g. Binding No. 4 – b4+0cr.+ lamination + embossing (foil), coated paper 150 gr. The edition is 500 copies.	The book "Abylaykhan dauirindegi Kazak–Qin karym-katynastary" (1-2 volumes) is a fundamental study of the political, diplomatic and military-strategic relations of the Kazakh Khanate with the Qing Empire during the reign of Abylai Khan based on written sources. The work has a high scientific value for studying the foreign policy of the Kazakh statehood and can serve as a reliable source base for historical and historiographical research.	5237000	1	5237000		100%	Поставлено

Барлығы: 25 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР23488882	Monoblock	27" Моноблок Моноблок Monoblock 27 Full HD, Intel Core i5, 16ГБ DDR4, 512ГБ SSD, Windows 11 Professional	Purchase of monoblocks for the opening of the Academic writing center	465455	1	465455	may	100%	Поставлено
АР23488882	Speaker	Frequency range 80-18000 Hz	Purchase of a speaker for working with electronic educational resources	9788	1	9788	may	100%	В период поставки
АР23488882	polygraphy services	Publication of the manual	development of students' academic writing skills in English	4000	100	400000	may	100%	Поставлено
АР23488882	polygraphy services	Publication of the manual	development of students' academic writing skills in English	4000	100	400000	may	100%	Поставлено
АР23488882	polygraphy services	publication of the monograph	Systematization and dissemination of knowledge gained during the project implementation process	4500	100	450000	may	100%	В период поставки
АР23488882	polygraphy services	publication of an analytical review	Dissemination of information on the research topic	2500	50	125000	may	100%	В период поставки
АР23488882	polygraphy services	Assigning an ISBN code	Identification of book publications	11000	4	44000	may	100%	Поставлено
АР23488882	The MLS400 Residual Current Device	The MLS400 Residual Current Device is designed to protect people—primarily the operator—from electric shock due to direct or indirect contact with live electrical parts, and also to safeguard laboratory equipment and installations from fault currents and harmful electrical impacts.	needed for the completion of the project	1600000	1	1600000	may	50/50%	Поставлено
АР23488882	Purchase of office supplies	A4 office paper, 80 gr. - 20 pcs., notebook-diary - 2 pcs.	for the implementation of the project	53821	1	53821		100%	В период поставки

Барлығы: 9 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992914	Scientific research service	1. Research on the production of biohydrogen, bioethanol, and biobutanol from distillery waste, coffee, their various mixtures, fruit waste and their mixtures with glycerol and coffee using different bacteria. 2. Study of changes in metabolic properties and pathways in wild-type S. cerevisiae (W303-1B) and mutant strains (Δhap4, ρ0) under fermentation and respiration conditions at different external pH levels and carbon sources.	The service is necessary to complete the project.	10000000	1	10000000	april	50/50%	Поставлено
BR24992914	Scientific research service	- Conducting research on the use of hydrogen for the extraction of valuable organic compounds from lignocellulosic materials. - ⁠Conducting research on the analysis of total phenolic content, flavonoids, anthocyanins, beta-carotene, chlorophyll a and b, as well as phenolic profile, organic acid profile, sugar profile, and vitamin C content	The service is necessary to complete the project.	6000000	1	6000000	april	50/50%	Поставлено
BR24992914	Scientific research service	Study of substance composition: analysis of sugars by HPLC, organic acids, and other components	The service is necessary to complete the project.	988000	1	988000	may	50/50%	Поставлено
BR24992914	Scientific research service	Conducting research and development of new bifunctional materials for capturing and processing by-products from molecular hydrogen production: synthesis of activated carbon from plant waste, testing the resulting material as a sorbent for carbon dioxide (CO₂) capture, determining CO₂ sorption capacity, and studying the main CO₂ sorption sites using temperature-programmed desorption (TPD-CO₂) method	The service is necessary to complete the project.	5000000	1	5000000	may	50/50%	Поставлено
BR24992914	Scientific research service	Modernization and update of the scientific program website	The service is necessary to complete the project.	130000	1	130000	May	50/50%	Поставлено
BR24992914	Scientific research service	Provision of the service for preparing and filing a utility model patent application	The service is necessary to complete the project.	400000	1	400000	may	50/50%	Поставлено
BR24992914	Cuvette test COD, measuring range 5–60 mg/l, 25 tests LCK1414	For measuring low concentrations of COD	Needed for photometric analysis required to evaluate experimental results	178000	1	178000	-	50/50%	В период поставки
BR24992914	COD cuvette test measuring range 100–2000 mg/l, 25 tests LCK514	For analyzing medium COD concentrations	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	181000	В период поставки
BR24992914	COD Test’N Tube, measuring range 200–15000 mg/l, 150 tests 2415915	For determining high COD concentrations	Needed for photometric analysis required to evaluate experimental results	595000	1	595000	-	50/50%	В период поставки
BR24992914	LCK338 Laton Total Nitrogen cuvette test 20–100 mg/l, 25 tests LCK338	For measuring total nitrogen in water samples.	Needed for photometric analysis required to evaluate experimental results	225000	1	225000	-	50/50	В период поставки
BR24992914	Phosphate (ortho/total) cuvette test measuring range 0.05–1.5 mg/l PO₄-P, 25 tests LCK349	For precise determination of low concentrations of ortho- and total phosphate	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	50/50%	В период поставки
BR24992914	Phosphate (ortho/total) cuvette test measuring range 2.0–20 mg/l PO₄-P, 25 tests LCK350	For analyzing higher concentrations of ortho- and total phosphate	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	50/50%	В период поставки
BR24992914	Organic Acids cuvette test measuring range 50–2500 mg/l, 25 tests LCK365	For determining organic acid content	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	50/50%	В период поставки
BR24992914	Dipotassium phosphate trihydrate (K₂HPO₄·3H₂O, hydrated)	A white crystalline powder, highly soluble in water. The aqueous solution is slightly alkaline. Molecular weight: 228.22 g/mol.	Buffering agent, stabilizer, used in laboratories and microbiological media.	250000	1	250000	-	50/50	В период поставки
BR24992914	Peptone (meat-based), AR Grade/GR (500 g)	А product of partial enzymatic breakdown of animal protein (usually of meat origin), which is a light beige powder, highly soluble in water, of AR Grade / GR purity class, suitable for microbiological and biochemical research.	Required for biochemical and microbiological research	90000	1	90000	-	50/50	В период поставки
BR24992914	Bacteriological agar (agar-agar), AR Grade/GR (500 g)	A naturally occurring polysaccharide isolated from red algae (Rhodophyceae). Appearance: Light beige granules or powder, odorless. Solubility: Soluble in hot water, forms a strong gel upon cooling. Purity: AR Grade / GR – analytical and guaranteed purity, suitable for microbiological and biochemical research.	Required for biochemical and microbiological research	252000	1	252000	-	50/50	В период поставки
BR24992914	Sodium carbonate (Na₂CO₃)	An inorganic compound that is a white crystalline powder, highly soluble in water, with an alkaline reaction; it is used as an analytical grade reagent (AR Grade / GR) in laboratory, microbiological, chemical and food analysis for the preparation of buffer solutions, acid neutralization, titrimetric determinations and pH regulation of the environment.	Necessary for the preparation of buffer solutions, neutralization of acids, titrimetric determination and regulation of pH of the medium.	43000	1	43000	-	50/50	В период поставки
BR24992914	Folin–Ciocalteu reagent (indicator), 500 mL	A bluish-green chemical reagent, a mixture of phosphomolybdic and phosphotungstic acids, used as a redox indicator in biochemical and analytical studies. It is used for the quantitative determination of phenolic compounds, amino acids, and proteins (e.g., in the Lowry method, for determining total polyphenol content using Gall or Gallic acid).	Required for quantitative determination of phenolic compounds, amino acids and proteins	180000	1	180000	-	50/50	В период поставки
BR24992914	Aluminum chloride (AlCl3) (1 kg)	An inorganic compound that appears as white or slightly yellowish crystals, highly soluble in water, ethanol, and other polar solvents. It is highly hygroscopic and has an acidic solution. It is used as an analytical-grade reagent (AR Grade/GR) in laboratory, chemical, and biochemical analyses.	Required for biochemical and microbiological research	47000	1	47000	-	50/50	В период поставки
BR24992914	Aluminum chloride (AlCl₃), 1 kg/Sodium acetate (CH₃COONa), anhydrous, 1 kg	Anhydrous is an inorganic compound that is a white, odorless, crystalline powder (or granules), highly soluble in water, alcohols and glycerin, with a slightly alkaline reaction, a molecular weight of 82.03 g/mol	Required for biochemical and microbiological research	109000	1	109000	-	50/50	В период поставки
BR24992914	Potassium-sodium tartrate tetrahydrate, analytical grade, EMSURE® ACS, ISO, Reag. Ph Eur (100 mL)	A crystalline inorganic compound that appears as colorless or white crystals, readily soluble in water, with a neutral or slightly alkaline reaction; it is used as a reagent of high analytical purity (meets the requirements of ACS, ISO, and the European Pharmacopoeia)	Required for biochemical and microbiological research	135000	1	135000	-	50/50	В период поставки
BR24992914	Glucose, 500 g	An organic compound that is a white crystalline powder with a sweet taste, highly soluble in water, belonging to the monosaccharides (aldehyde alcohols); it is used in biochemical, microbiological and analytical studies as a source of carbon and energy, as well as in nutrient media, fermentation processes and standard solutions due to its high purity (AR Grade / GR).	Required for biochemical, microbiological and analytical research.	18740	1	18740	-	50/50	В период поставки
BR24992914	Sodium hydroxide (NaOH)	А white crystalline substance with a strong alkaline reaction, highly soluble in water, used as an analytical-grade reagent for neutralizing acids and preparing solutions in chemical and biochemical analysis.	Required for biochemical and microbiological research	15000	1	15000	-	50/50	В период поставки
BR24992914	Potassium hydroxide (KOH)	A white crystalline substance with a strong alkaline reaction, readily soluble in water and alcohols; used as an analytical-grade reagent for neutralizing acids and preparing buffer solutions.	Required for biochemical and microbiological research	71840	1	71840	-	50/50	В период поставки
BR24992914	Yeast extract	A nutrient component in the form of a light beige powder, highly soluble in water; used as a source of amino acids, vitamins, and growth factors in microbiological nutrient media.	Required for biochemical and microbiological research	78000	1	78000	-	50/50	В период поставки
BR24992914	Potassium dichromate (K₂Cr₂O₇), Extra Pure	Orange-red crystals, highly soluble in water; strong oxidizing agent, used as a high-purity reagent (EXTRA PURE) in analytical chemistry, titrimetry and photometry	Required for biochemical and microbiological research	64000	1	64000	-	50/50	В период поставки
BR24992914	Storage cabinet MD 4-800	Reagent storage cabinet, W800 x D400 x H1750 + 100 + 70 mm: The cabinet is made of steel, with a 0.6 mm thick frame and 0.7 mm thick door. The door is equipped with key locks (one is installed on the top and one on the bottom door). The handle is plastic (125 mm). The maximum load on the metal shelf is 30 kg. There are two shelves in the upper section and two shelves in the lower section. The shelves are perforated for ventilation. A 100 mm diameter metal pipe is attached to the top. The lower part of the rear wall is equipped with ventilation holes.	Required for storing chemical reagents	460000	1	460000	-	50/50	В период поставки
BR24992914	"Holographic displays and holographic systems"	Displays and holographic systems" Golo " - 144×81 cm internal Composite display-column, including manufacturing and installation	Equipment is necessary to implement the project	3000000	1	3000000		50/50%	В период поставки

Барлығы: 28 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP23485629	A test kit for determining the antibiotic in meat and milk	The test kit is designed for rapid and accurate detection of antibiotic residues in meat and milk, including tetracyclines, beta-lactams, streptomycin, chloramphenicol, and sulfonamides. It offers high sensitivity, is easy to use, and suitable for both laboratory and field applications.	Research within the project	4041401	1	4041401	may	50/50%	Поставлено
AP23485629	Chromatographic column	Research within the project	A chromatographic column is intended for the separation and quantitative analysis of antibiotics using liquid chromatography. The column is a cylindrical tube packed with a stationary phase (sorbent), through which a mobile phase (eluent) is passed. Due to the interaction between antibiotics and the sorbent, effective separation is achieved, enabling accurate determination of their quantitative levels in the analyzed samples.	1	1	1	may	50/50%	Поставлено
AP23485629	Fridge	Temperature range: +2…+8 °C Volume: 300 L Cooling system: static Control: electronic with display Body: metal, inner chamber — ABS/stainless steel Shelves: adjustable Alarm system: temperature, door, power supply Power supply: 220 V, 50 Hz Additional features: lock, temperature recording, emergency power supply	Research within the project	300	1	300	may	50/50%	Поставлено
AP23485629	Standard sample for Akvilon AKV-07MK (set)	Purpose: Calibration and testing of the Akvilon AKV-07MK gas analyzer Set includes: cylinders with standard gas mixtures, pressure regulator, connection hoses, certificate Gas types: methane (CH₄), propane (C₃H₈), butane (C₄H₁₀), others upon request Cylinder volume: 1–5 L (depending on configuration) Pressure: up to 150 atm Composition accuracy: ±2% Storage conditions: +5…+25 °C, dry environment Shelf life: up to 2 years	Research within the project	801	1	801	may	50/50%	Поставлено
AP23485629	Electric Meat Grinder QJH-C12A	The QJH-C12A electric meat grinder is designed for fast and efficient meat processing in kitchens and small production facilities. It features a 750 W motor operating on 220 V, providing a capacity of up to 120 kg per hour. The housing, knives, and grinding plates are made of stainless steel, ensuring durability and sanitary safety. With a weight of about 19 kg and compact dimensions, the unit is suitable for tabletop installation. Country of origin: China.	Required for sample preparation and grinding of meat materials during laboratory studies within the scientific project.	150000	1	150000	April-December	50/50%	В период поставки
AP23485629	Tagler PN-3030Ch Laboratory Heating Plate	The laboratory hot plate TAGLER PN-3030CH is designed for general heating, drying and thermal treatment of solutions, mixtures, samples and specimens. Its working surface is cast iron, size 300×300 mm, providing uniform heat distribution; the temperature range is from +50 °C to +400 °C. The plate has power of 3 kW and is powered from a 220 V mains. Its dimensions are approximately 320×350×140 mm, weight up to 12 kg. Temperature is controlled simply via a rotary knob — easy operation.	For laboratory experiments requiring heating, drying or thermal treatment of solutions and samples.	290000	1	290000	April-December	50/50%	В период поставки
AP23485629	Laboratory Scales VK: VK-600.1 (Massa-K)	VK-600.1 laboratory scales are designed for static mass measurements with high accuracy. Maximum weighing capacity is 600 g, readability (division) is 0.02 g. The weighing platform is round (Ø 120 mm) and includes a draft shield. Scales have an LCD display with backlight, can operate from mains or internal battery, support multiple weighing modes: weighing, tare compensation, total mass calculation, percentage and counting modes. An RS-232 interface is available for connection to a computer.	Required for precise measurement of samples, reagents and components during sample preparation and laboratory analytical studies.	180000	2	360000	April-December	50/50%	В период поставки
AP23485629	Anatomical Tweezers	An anatomical tweezers is a laboratory instrument used for precise gripping, holding and transferring small samples, tissues and materials. Typically made of stainless steel, it features serrated tips for secure handling without damaging the specimen. Used in biological, veterinary, medical and chemical laboratories.	Required for precise sample handling during laboratory research, sample collection and material preparation within the scientific project.	3000	5	15000	April-December	50/50%	В период поставки
AP23485629	Knife Set (China)	A knife set is a collection of versatile cutting tools used for processing, slicing and preparing various samples and materials. The blades are typically made of stainless steel for durability and corrosion resistance, while the handles are made of plastic or composite materials for safe and comfortable grip. Suitable for laboratory, training and general-purpose applications.	Required for preparation and cutting of samples during laboratory experiments and practical tasks within the scientific project.	15000	2	30000	April-December	50/50%	В период поставки
AP23485629	Cutting Board (China)	A cutting board is used to safely and conveniently prepare samples, products and materials. It is typically made of moisture-resistant plastic or wood-polymer composites, providing a durable and easy-to-clean surface. It offers a stable working area and protects laboratory benches from damage.	Required for preparation and handling of samples during laboratory procedures and research within the scientific project.	9000	2	18000	April-December	50/50%	В период поставки
AP23485629	Surgical Scissors. Material — Stainless Steel	Surgical scissors are made of corrosion-resistant medical stainless steel suitable for repeated sterilization. They provide precise cutting of soft tissues, materials, and laboratory supplies. Compatible with autoclaving and chemical disinfection.	Needed for precise cutting of samples and materials in veterinary-sanitary examinations	10000	5	50000	April-December	50/50%	В период поставки
AP23485629	Surgical Tweezers 200 mm	The 200 mm surgical forceps are made of medical stainless steel resistant to corrosion and repeated sterilization. They ensure a secure grip of tissues, materials, and small objects. The gripping surfaces are textured to prevent slipping and provide precise handling.	Required for gripping and holding samples and materials in veterinary-sanitary examinations.	2500	5	12500	April-December	50/50%	В период поставки
AP23485629	Gram Staining Kit	The Gram staining kit includes crystal violet, Lugol’s iodine solution, a decolorizer (alcohol or acetone-based), and a counterstain (safranin or fuchsin). It is designed for differential staining of bacteria into Gram-positive and Gram-negative groups. Provides clear visualization of bacterial morphology and cell structure. Suitable for use in microbiological laboratories of various profiles.	Required for detecting and differentiating bacteria during laboratory analyses.	14000	3	42000	April-December	50/50%	В период поставки
AP23485629	Chemical Reagents Kit for Veterinary-Sanitary Meat Examination (Medstandart Russia)	The chemical reagents kit for veterinary-sanitary meat examination (Medstandart, Russia) contains reagents for key qualitative and rapid tests, including assessment of meat freshness, detection of ammonia, amines, hydrogen sulfide, peroxidase activity, residual chlorine, and pathological changes. The reagents are supplied in sealed containers, stable during storage, and suitable for both field and laboratory use.	Required for performing qualitative tests and evaluating meat freshness during laboratory analyses.	30000	3	90000	April-December	50/50%	В период поставки
AP23485629	Chemical Reagents Kit for Veterinary-Sanitary Examination of Milk and Dairy Products (Medstandart Russia)	The chemical reagents kit for milk and dairy product testing (Medstandart, Russia) contains reagents for determining fat, protein, acidity, acid number, antibiotic residues, and other quality parameters. The reagents are supplied in sealed containers, stable during storage, and suitable for laboratory and field use.	Required for qualitative analysis of milk and dairy products during laboratory analyses.	30000	3	90000	April-December	50/50%	В период поставки

Барлығы: 15 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР19680287	Automatic press for mounting metallographic samples МР-3000	The DTQ-5 model with low cutting speed is suitable for precise cutting of various hard materials, especially for all kinds of small metal, non-metal parts and various electronic components. Specifications: Positioning accuracy: 0.01mm; Rotation speed: 0-700rpm; Blade diameter: Ø100 - 150mm; Power: 220V/110V, 50Hz; Dimensions: 350x350x200mm; Weight: 18.5kg.	As part of the implementation of this project, a study is being conducted on the effect of local electrolytic plasma hardening (EPH) on the structure and properties of steel parts of a freight car bogie. For a detailed analysis of the structure of the hardened layer, it is necessary to conduct metallographic studies that require the preparation of high-quality sections. One of the critical stages of preparation is the precise and accurate cutting of samples from large and hard metal parts. This requires the use of specialized cutting equipment that ensures precision cutting without overheating and deformation of samples. The optimal solution is the DTQ-5 cutting machine, which will allow you to prepare samples with high accuracy, efficiency and safety.	1	1	1	april	50/50%	Поставлено
АР19680287	Metallographic grinding and polishing machine LMP-3S	LMP-3S is a multifunctional equipment designed for preparing metallographic samples. It combines preliminary grinding, coarse and fine grinding, as well as coarse and fine polishing. The machine features a powerful motor, low noise level, high reliability and ease of operation, which makes it an ideal choice for industrial enterprises and research organizations. Working disk diameter - 250 mm Working disk speed - 50-1000 rpm (smooth adjustment), fixed speeds: 400/600/800/1000 rpm Direction of rotation - clockwise and counterclockwise Speed of grinding/polished head - 5-10 rpm (smooth adjustment) Number of samples processed simultaneously - 6 pcs. Load range – 0-0.7 MPa (adjustable, factory setting ≤ 0.2 MPa Sample preparation time – 0-3000 seconds Sample diameter – 30 mm Input voltage – single-phase 220 V ± 10%, 50-60 Hz Total power – 900 W Overall dimensions – 790 x 740 x 700 mm Weight (net) - 89.6 kg	The hardened layer after EPU has a complex structure, requiring high-quality surface preparation for correct analysis. The LMP-3S machine allows you to get a perfectly smooth surface without artifacts. The automated grinding and polishing process ensures the same processing parameters for all samples, eliminating the influence of the human factor. Manual sample preparation takes a lot of time and requires highly qualified operators. The LMP-3S significantly speeds up the process due to automatic control of pressure, speed and processing time.	3	1	3	april	50/50%	Поставлено
АР19680287	Automatic feeding system for dosing and polishing 2T	The 2T Automatic Polishing Feed System is a device that integrates a precise peristaltic pump, touch screen display and intelligent liquid feed control. The device automatically adjusts the feed intervals and power, ensuring uniform distribution of grinding and polishing suspension in the required volume and at a given speed. Model - 2T Liquid bottle capacity - 500ml*2 Control and display - touch screen Natural motor - DC motor Power - 200V, 50Hz Size - 210x280x260mm	The purchase of the system is justified by the need to improve the accuracy and efficiency of the polishing process for steel parts of a freight car bogie when preparing their surface for analysis after local electrolytic-plasma hardening. Automatic supply of suspensions allows for precise control of the amount and uniformity of application of the polishing material, reducing the likelihood of human error and ensuring process stability. This improves the quality of the final polishing, which is critical for obtaining reliable data in microstructural analysis and assessing the properties of hardened parts.	540	1	540	april	50/50%	Поставлено
АР19680287	Medical electric water distiller type AE according to TU 9452-01-22213860-2009 in the version: AE-10/20 (with a built-in water collector)	Production of distilled water of type 3 according to GOST R 58144-2018 ""Distilled water"", FS.2.2.0019.18 ""Water for injection"" Productivity - 10 l / h Volume of water separator - 20 l Cooling water consumption - 75 l / h Source water pressure - 0.1 ... 0.4 MPa Specific conductivity of water at the outlet 2 ... 2.5 μS / cm Temperature of produced water - 24 ... 40 ℃ Power supply - 380 V, 50 Hz Power consumption - 7.2 kW Dimensions - 425x425x775 mm Weight - 22.8 kg Water purification coefficient from radionuclides is not less than 4000 Average service life - 10 years	The project requires distilled water, which is the main component of electrolytes used in the process of local electrolytic-plasma hardening. The new premises do not have a distiller, which complicates the research. The purchase of AE-10/20 is necessary for the uninterrupted conduct of experiments and increasing the efficiency of the laboratory.	617	1	617	april	50/50%	Поставлено
АР19680287	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base.	400000	5	2000000	april	50/50%	В период поставки
АР19680287	Analytical laboratory scales ADAM HCB	Maximum weighing capacity (MWC), g: 120 Readability, g: 0.001 Dimensions (W×D×H), mm: 172×251×75 Weight, kg: 2	The project requires high-precision equipment to carry out accurate measurements of sample mass. ADAM HCB analytical laboratory scales will provide the necessary accuracy and stability in measurements, which is critical for the correctness of all experimental data.	340	1	340	april	50/50%	Поставлено
АР19680287	Sanding paper	Diameter: 250 mm Grit size: 100–2500	The sample preparation for this project requires the use of abrasive papers with different grits to ensure the required surface quality for subsequent metallographic analysis. Different paper grits allow for efficient grinding at different stages of sample preparation, from rough grinding to final polishing.	580	1	580	april	50/50%	Поставлено
АР19680287	Epoxy resin for embedding samples	Epoxy resin for embedding samples for SEM	To prepare samples of steel parts of a freight car bogie subjected to local electrolytic-plasma hardening, epoxy resin is required for their pressing before conducting metallographic analysis. This will ensure stability and convenience during processing and research. Epoxy resin has excellent adhesion and strength, which guarantees reliable fixation of samples and their protection from damage during grinding and polishing.	210	1	210	april	50/50%	В период поставки

Барлығы: 8 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР19579513	Automatic press for mounting metallographic samples MP-3000	Mold diameter – 30 mm Parameter programming – programmable database, up to 99 assembly methods maximum number of samples – 2 pcs. per cycle Heater power – 2000 W Temperature range – 0-200℃ (adjustable) Heating time range – 0-30 minutes Pressure range 0-6 MPa (adjustable) Total assembly time – 6 min Pressure mode – automatic (electro-hydraulic system) Cooling system – automatic water cooling Control type and display – 7-inch touch screen Operating mode – automatic/manual Power consumption – 2200 W Power supply – AC 220V, 50Hz Dimensions/weight – 630x520x480 mm, 120 kg	The project includes a study of the structure and properties of surface-hardened stainless steel parts. This requires metallographic analysis, which requires the preparation of high-quality sections. One of the key stages of preparation is the installation of samples in polymer molds, which ensures the convenience of their subsequent processing and analysis.	4401140	1	4401140	april	50/50%	Поставлено

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23488875	Monoblock	27" Full HD, Intel Core i5, 16ГБ DDR4, 512ГБ SSD, Windows 11 Professional	Procurement of all-in-one computers for the establishment of an academic writing center	569000	1	569000	may	100%	Поставлено

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP23488216	Performing physico-chemical analyses of iron nanoparticles	3 samples, X-ray phase analysis (Pan Analytical XPert Pro) of iron nanoparticles with interpretation; scanning electron microscopy (SEM) of iron nanoparticles with interpretation; determination of the average size (Laser Particle analyser Winner-2005A) of iron nanoparticles with interpretation; UV spectrometric analysis of 190-1100 nm (PE-5400UV) with interpretation	Conducting physicochemical analyses will be necessary to ensure the accuracy and speed of scientific results	231600	1	231600	February	50/50%	В период поставки
AP23488216	Performing chemical analyses of animal blood samples	4 samples - total blood count + leukocyte formula	Conducting physicochemical analyses will be necessary to ensure the accuracy and speed of scientific results	67200	1	67200	February	50/50%	В период поставки
AP23488216	Chemical reagents, laboratory utensils and equipment	Antiseptic, Formalin of the FM brand in/ with GOST 1625-2016, Aqueous ammonia, Carbon 4-chloride, Heptane, crystalline iodine, Sodium chloride BDA GOST 4233-77, Barium chloride 2-water, Silver nitrate HC GOST 1277-75, iron chloride (III) 6-water, Lead nitrate, Lead sulfate, Bromocresol purple, Zinc nitrate, Sucrose, Hydrogen Peroxide, Glucose, Fructose, Potassium chloride, Potassium iodide, Nitric acid 57%, pH measurement (6 ampoules) TU 2642-004-33813273-2006 according to GOST 8.135-2004 (1,65; 3,56; 4,01; 6,86; 9,18; 12.43 3rd grade, Sodium hydroxide 0.1N (10 ampoules) TU 2642-001-33813273-97, ST Trilon B, Hexane BDA, Cationite, Ammonium bicarbonate, Porcelain high crucible No. 2 8 ml GOST 9147-80, Porcelain evaporation cup No. 4 150 ml GOST 9147-80, Universal indicator paper pH 0-12, Laboratory filter paper F GOST 12026-76, Alcohol burner SL-2, Porcelain spoon No. 1 120 mm GOST 9147-80, Porcelain spatula 250 mm, Glass wand 5mm/220 mm, Large tube brush L=12 cm, 16 cm handle, Medium tube brush L=24 cm, Respirator Istok -400 (RU-60M), Alcohol thermometer 0 +100 IT-2, Electronic thermometer -50+300C probe 100 mm, Thermometer TS-7-M1 isp.6 (-20...+70C) warehouse (TS-7-M1-6), Thermometer TS-7-M1 isp.6 (-30...+30C) for refrigerator (TS-7-M1-6), Thermometer TTJ-M P No.4 240/103 0+100 alcohol c.d. 1 g, Thermometer TTJ-M N No.5/103 0+150 alcohol c.d. 1 gr, Thermometer TTJ-M N No.6/103 0+200 alcohol c.d. 2 gr	It will be used in the preparation of chlorella growing media and in the conduct of physico-chemical analyses.	628798	1	628798	February	100% постоплата	В период поставки

Барлығы: 3 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992870	DTS sensor	Technical Specifications TDS Signal Adapter Board: - Input Voltage: 3.3 ~ 5.5 V - Output Signal: 0 ~ 2.3 V - Operating Current: 3 ~ 6 mA - TDS Measurement Range: 0 ~ 1000 ppm - TDS Accuracy: ±10% F.S. (25°C) - Size: 42 × 32 mm - Module Interface: XH2.54-3P - Electrode Interface: XH2.54-2P TDS Sensor: - Number of Sensors: 2 - Total Length: 83 cm - Connection Interface: XH2.54-2P - Color: White - Other: Waterproof sensor Package Includes: - 1 × TDS Signal Adapter Board - 1 × Waterproof TDS Sensor - 1 × Analog Sensor Cable Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	PH sensor	Amplifier Board: Power Supply Voltage: 5±0.2 V Operating Current: 5–10 mA Operating Temperature: -10…50 °C Service Life: 3 years Dimensions: 42 mm × 32 mm × 20 mm Weight: 25 g pH Sensor: pH Range: 0–14 pH Measured Solution Temperature Range: 0–60 °C Zero Point: 7 ± 0.5 pH Response Time: ≦1 min BNC Connector Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Temperature sensor	Technical Specifications: Type: NTC Thermistor Resistance: 10 kΩ (at 25°C) B-constant: 3380K ±1% Peak Voltage: AC 1800V (1 mA, 2 sec) Dissipation Power: 5 mW/°C Probe Insulation: >100 MΩ Measurement Range: -20…+105°C (accuracy decreases below -20°C) Probe Diameter: 5 mm Probe Length: 25 mm Cable Length: 1 m Casing Material: Stainless Steel Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Water level sensor	Sensor Material: Stainless Steel Cable Length: Approx. 30 cm Float Diameter: 28 mm Float Height: 28 mm Sensor Length (without wires): 100 mm Mounting Thread: M10 Operating Temperature: -30 ℃ ~ +125 ℃ Color: Silver Contact Voltage: AC/DC 100V (max 220V) Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Arduino Kit	Arduino Mega 2560 R3 Microcontroller: ATmega2560 Clock Speed: 16 MHz Flash Memory: 256 KB SRAM: 8 KB EEPROM: 4 KB Logic Level Voltage: 5 V Input Supply Voltage: 7–12 V Maximum 5V Pin Output Current: 1 A	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Aluminum X-shaped profile	Dimensions: 40×40 mm Slot Width: 10 mm Coating: Anodized layer Weight: Approx. 1.62 kg/m Design: Special cross-section designed to increase resistance to bending and torsion	Equipment is necessary to implement the project.	100	1	100	may	100%	Поставлено
BR24992870	100мм Elbow for PVC pipe 100mm	Type: Elbow Pipe Diameter: 100.0 mm Angle: 90.0° Dimensions: 100 Color: White Material: Polypropylene	Equipment is necessary to implement the project.	40	1	40	may	100%	Поставлено
BR24992870	Corner for fixing aluminum profile	astener Type Included: Mounting bracket (angle) Purpose: For installation, For aluminum Length: 20 mm Width: 20 mm Material: Aluminum Color: Gray	Equipment is necessary to implement the project.	40	1	40	may	100%	Поставлено
BR24992870	PVC coupling 100mm	Equipment is necessary to implement the project.	Type: Coupling Pipe Diameter: 100.0 mm Dimensions: 100 Material: Polypropylene	20	1	20	may	100%	Поставлено
BR24992870	Cable	Type of Cable Product: Cable Cable Type: Household, Power Marking: PVS Number of Cores: 2 Cross-Section: 2.5 mm² Length: 1.0 m Conductor Material: Copper Application: Indoor, Outdoor Sheath Material: PVC compound Insulation Material: PVC	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Container 30l	Type: Container Shape: Rectangular Material: Plastic Lid: Included Handles: Included Width: 390 mm Length: 620 mm Height: 190 mm Volume: 30 L	Equipment is necessary to implement the project.	30	1	30	may	100%	Поставлено
BR24992870	Seedling cups	Type: Pot Purpose: For seedlings Material: Plastic Shape: Round Color: Black Drainage Holes: Yes Size: 45×55 mm	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	power unit	Compatibility: For video surveillance, LED strips, power supply Device Type: Power supply unit Voltage: 12V Dimensions: 19 x 9 x 4 cm Operating Temperature: -10°C ~ +60°C	Equipment is necessary to implement the project.	100	1	100	may	100%	Поставлено
BR24992870	Tube 8 mm	Net Weight: 0.583 kg Tube Diameter: 8 mm Hose Length: 25 m Tube Material: PVC	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Bolts nuts	Type: Bolt Length: 35 mm Diameter: 6 mm Set Includes: Bolt, nut, washer	Equipment is necessary to implement the project.	20	1	20	may	100%	Поставлено
BR24992870	Ultraviolet lamp	Base Type: No base Lamp Type: Ultraviolet Number of Light Sources: 96 Power of Light Source: 100 W Luminous Flux: 16,000 lm Color Temperature: 16,000 K Mounting Type: Pendant Material: Aluminum Dimensions: 12 x 23 cm Color: Black	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Extension cord	USB Port: Yes Light Indicator: Yes Cable Length: 2.0 m Dimensions (W×H×D): 170 × 100 mm Built-in Charging Ports for Phones and Gadgets: 4× USB, 2× Type-C Type: Power strip Number of Sockets: 3 Socket Type: Type C (Euro standard with grounding) Input Voltage: 220.0 V Rated Current: 10.0 A Color: Black	Equipment is necessary to implement the project.	10	1	10	may	100%	Поставлено
BR24992870	Automatic screwdriver	Impact Function: No Functions: Reverse, Drilling Package Includes: Case Battery Voltage: 20.0 V Battery Type: Li-Ion Battery Capacity: 2.0 Ah Battery Charging Time: 1.0 hour Power Supply: Battery-powered Battery and Charger Included: Yes Chuck Type: Keyless Tool Type: Drill-driver Number of Speeds: 2 Chuck Diameter: 10 mm Max No-load Speed: 1400 rpm Max Torque: 45.0 Nm	Equipment is necessary to implement the project.	2	1	2	may	100%	Поставлено
BR24992870	Soldering iron	Material (Handle): Plastic Dimensions: 26×15×5 cm Set Includes: Soldering iron; 5 tips; rosin; stand; desoldering pump; sponge; solder wire; wire stripper; 2 jumper wires; 2 tweezers; 6 hooks; screwdriver with 5 bits Additional Info: Comes in a carrying bag Type: Soldering Iron Power: 60.0 W Power Adjustment: Smooth (stepless) Power Supply: AC mains Input Voltage: 220 V Soldering Station Features: Adjustable temperature Model/Item Code: SIK008 (26 items) Heater Type: Ceramic Min. Heating Temperature: 200.0 °C Max. Heating Temperature: 450.0 °C Temperature Stabilization: Yes Tip Material: Copper with coating	Equipment is necessary to implement the project.	2	1	2	may	100%	Поставлено
BR24992870	Roller pipe cutter 100 mm	Pipe Cutter Type: Roller Type: Pipe Cutter Compatible Pipe Types: Metal-plastic, PVC, HDPE, polypropylene, PEX, CPVC Drive Type: Manual Max Diameter: 110.0 mm Power Supply: None (manual operation)	Equipment is necessary to implement the project.	2	1	2	may	100%	Поставлено
BR24992870	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base.	400000	2	800000	may	50/50%	Поставлено
BR24992870	Laptop	Screen Diagonal screen: 16.0 inches Screen resolution: 2560x1600 2.5K Screen refresh rate: 240 Hz Screen brightness: 500.0 cd/m2 Screen coating: matte Touch screen: no Matrix type: IPS Processor Maximum processor frequency: 4900.0 MHz Processor: Intel Core i7-13650HX Base frequency of the processor: 2600.0 MHz Number of processor cores: 14 cores Cache size: L324 MB memory RAM size: 16.0 Gb Memory type: DDR5 Memory frequency: 4800.0 MHz Maximum memory size: 32.0 Gb Number of memory slots: 2 Storage device Hard disk type: SSD Total storage volume: 1000.0 Gb Storage interface: SSD Video Type of video adapter: discrete and integrated video card Video card: NVIDIA GeForce RTX 4060 + Intel UHD Graphics Video memory type: GDDR6 Video memory size: 8192.0 Mb Wireless communication and connection Standard Wi-Fi 802.11ax Bluetooth version: 5.3 Network card built-in network card, 1000 Mbit/c Number of interfaces USB 3.12 Interface: Thunderbolt 4, USB 3.2 Gen1 Type-A, USB 3.2 Gen2 Type-C Input: microphone/headphone combo Outputs: HDMI, RJ-45 Sound and input devices: Sound 2 speakers with the technology of intelligent amplification Smart AMP Positioning devices: NumberPad Backlit keyboard: Yes Keyboard layout: Russian, English Features and additional information Camera Resolution: 720p HD Additional information Technology NVIDIA Advanced Optimus Display ROG Nebula Response time 3 ms Color gamut DCI-P3 100% Support for technologies Dolby Vision HDR and Dolby Atmos 2 dynamics with technology of intelligent amplification Smart AMP Certification Hi-Res Technology of intellectual noise reduction Nutrition Battery: 80-90 Wh Weight 2.6 kg	Successful implementation of the project requires modern computer equipment that ensures the execution of computational, analytical and design tasks. The project includes types of work directly related to the need to use a high-performance laptop.	1200000	1	1200000	August-October	50/50	Поставлено
BR24992870	Laptop	Display Screen Size: 14.0 inches Resolution: 1920 x 1200 WUXGA Refresh Rate: 60 Hz Screen Brightness: 400.0 cd/m² Screen Coating: Glossy Display Type: OLED Processor Maximum Processor Frequency: 4500.0 MHz Processor: Intel Core Ultra 5 125H Base Processor Frequency: 1200.0 MHz Number of Processor Cores: 14 Cores Cache Size: L318 MB Memory RAM Size: 16.0 GB Memory Type: LPDDR5X Memory Frequency: 7467.0 MHz Storage Devices Hard Drive Type: SSD Total Storage Capacity: 512.0 GB Flash Card Reader: Yes Video Video Adapter Type: Integrated graphics Graphics: Intel Arc Graphics Wireless and Connectivity Standard: Wi-Fi 802.11ax Bluetooth Version: 5.2 Number of Interfaces: USB 3.02 Interfaces: USB Type-C Sound: Front-facing speakers: 2 W x 2 Keyboard Backlight: Yes Keyboard Layout: Russian, English Features and Additional Information Camera: Infrared camera, physical shutter on the camera, 1080p FHD resolution Power Battery: Up to 57 Wh Weight and Dimensions	Successful implementation of the project requires modern computer equipment that ensures the execution of computational, analytical and design tasks. The project includes types of work directly related to the need to use a high-performance laptop.	690000	1	690000	August-October	50/50	Поставлено
BR24992870	Cold rolled sheet 3x1250x2500 mm 12X18N10T GOST 5582-75 GOST 19904-90 (2р), Circle Ø25 12Х18Н10Т L= 2-6m GOST 5949 2018 GOST 2590 (20р)	Product type: Cold rolled sheet (CR) Dimensions: thickness – 3 mm, width – 1250 mm, length – 2500 mm Steel grade: 12Х18Н10Т (stainless, corrosion-resistant, austenitic class) GOST: 5582-75 (for steel), 19904-90 (for sheet metal) Surface condition: cold rolled, polished/uncoate Material density: ~7.9 g/cm³ Weight of 1 sheet: ~74 kg (estimated: 3 mm × 1.25 m × 2.5 m × 7.9 t/m³) Product type: round rolled products (circle) Diameter: Ø25mm Length: 2–6m Steel grade: 12Х18Н10Т (stainless, corrosion-resistant, austenitic class) GOST: 5949‑2018 (for stainless steel), 2590 (for hot-rolled products) Condition: hot-rolled or calibrated	Cold-rolled sheet 3×1250×2500mm made of 12X18N10T steel will be used to manufacture experimental samples and parts as part of the project. The material is necessary for conducting a series of studies on the application and testing of coatings, since its characteristics will ensure the correctness and reproducibility of the experimental results. The Ø25mm circle made of 12X18N10T steel will be used to manufacture experimental blanks and parts required for conducting research within the framework of the project. The material will provide stable mechanical and corrosion properties, which will allow obtaining correct and reproducible test results.	859874	1	859874	August-October	50/50	Поставлено
BR24992870	Рowders for plasma surfacing	Stellite 12 Powder (Co-30Cr-8W-3Ni-2Fe-1.4C-1-2%Si-<1%Mn, 53-150 μm) 2x69 750=139 500 Stellite 21 Powder (27Cr–5.5Mo–2.8Ni–1.5Fe–1Si–0.25C, 53-150 μm) 2x69 750=139 500 Stellite 190 Powder (30Cr–12.5W–1.1Si–1.4C, 53-150 μm) 2x61 875=123 750 Deloro 56 Powder (<0.6C–17Cr–2.5Mo–4.5Si–3.6B–3Fe–2.5Cu, 53-150 μm) 2x70 000= 140 000 Deloro 60 powder (~0.7C–15Cr–4.4Si–3.1B–<4Fe, 53-150 μm) 2x70 000= 140 000 PS-12NVK-01 Powder 65% PG-10N-01 + 35% WC, 53-150 μm 2x75 000= 150 000 PR-7Kh5M4FGBR powder 53-150 μm 2x65 000= 130 000 High carbon, high chromium iron powder based powder (C 3.9%, Cr 26%, Si 1.5%, Ni 1.7%, W 0.3%, Mo 0.1%, Mn 1.1%, 53-150 μm) 2x60 000=120 000 Powder WC-20Ni (Tungsten carbide with nickel powder) (WC ~80%, Ni ~20%, 53-150 μm) 2x88 875= 177 750 Powder Co-Cr-W-Ni-Fe alloy powder (Co-Cr-W-Ni-Fe alloy powder, 53-150 μm) 2x101 250 = 202 500 Powder Ni-B-Si-Fe alloy with added tungsten carbides (Ni-B-Si-Fe alloy with added tungsten carbides, 53-150 μm) 2x72 000= 144 000	The powders specified will be used for plasma surfacing work within the framework of the project plan. Their chemical composition and dispersion will ensure the production of coatings with various physical, mechanical and corrosion-resistant properties, which is necessary for comparative studies and the selection of optimal application modes.	1610000	1	1610000	August-October	50/50	Поставлено
BR24992870	Diamond cutting disc 110201.0 mm, Metal cutting band saw 164138/12	for cutting hard materials 5x32 000=160 000, bi-metal, tooth pitch 8/12TPI 5x25 000=125 000	Their availability is necessary for sample preparation and assembly, surfacing, automatic and manual welding, and subsequent mechanical processing. The purchase of these consumables and equipment will ensure the smooth execution of technological operations and compliance with the project implementation deadlines.	285000	1	285000	August-October	50/50	Поставлено
BR24992870	Ammonia anhydrous liquefied with a reducer	Ammonia grade A, 40 l, reducer model: BAMO-1.21 (version 09) TU 26-05-25-84	A supply of process ammonia (NH₃) in cylinders is required, along with a two-stage pressure reducer (pressure regulator) and a safety kit to ensure stable, reproducible and safe operation of the ion-plasma nitriding (IPN) unit.	1325000	1	1325000	August-October	50/50	Поставлено
BR24992870	Laboratory and technological equipment, consumables and components	9.1-inch 4K monochrome LCD display - 1 pc (143,000) CCT-3320T conductivity monitor with CON-1134-13 conductivity sensor - 1 pc (33,600) MARK-902/1 pH meter - 1 pc (1,147,200) GP-902/1 Hydraulic panel for the MARK 902 BP31.07.000-01 device - 1 pc (345,000) BP31.02.700 flow-through cuvette - 1 pc (212,000) Single-channel compressor - 1 pc (5,800) 8x3.5 cm air pump - 1 pc (9,500) M5 carbon steel T-nuts, 3030, 50 pcs/pack - 3 pack (24,600) 3030-6 Aluminum Corner Brackets, 10 pcs/pack - 3 packs (20,700) 3030 Aluminum Profile, 1200 mm, 6 pcs/pack - 1 pack (24,500) 3030 Aluminum Profile, 900 mm, 20 pcs/pack - 1 pack (61,800) FD-100 Electric Exhaust Fan - 1 pc (25,900) T.XA-420-Kl1-1-8 Temperature Sensor 300-(0/+300°C) - 1 pc (65,500) DN-300 Vikhr Drainage Pump - 2 pcs (50,000) Dielectric Mat, 750*750 mm - 1 pc (6 800)	A set of equipment, instruments and consumables is necessary for equipping and modernizing the experimental installation, which is used in the framework of studies on the development and optimization of technological processes of surface treatment by ion-plasma and electrochemical methods. Ensuring the possibility of conducting accurate, reproducible experiments related to the control of physical and chemical parameters of the environment, as well as stable operation of auxiliary systems of the installation (gas, liquid, ventilation and measuring).	2176300	1	2176300	August-October	50/50	Поставлено
BR24992870	A service for conducting research on the elemental-phase composition and tribological properties of samples	Determination of the elemental phase composition of coatings (number of samples: 50). The elemental composition of the coatings was determined using energy-dispersive X-ray spectroscopy (EDS) on a scanning electron microscope (SEM) in secondary (SE) and backscattered electron (BSE) modes. For each sample, the elemental distribution across the cross-section was analyzed using linear analysis and elemental mapping covering the coating/substrate interface. Micrographs of the cross-section were also obtained at various magnifications (at least 3 magnified images). Result: SEM images, EDS spectra, and quantitative analysis of the elemental content. The phase composition was determined by X-ray diffractometry. Shooting modes: diffraction angle 20-90 degrees; shooting step 0.02 degrees; exposure time 0.5 seconds. Result: diffraction pattern without decoding and data in electronic format with a .txt file extension. 2.2 Study of the tribological properties of the coatings (number of specimens: 50). Tribological tests shall be carried out using the ball-on-disc method in accordance with ASTM G99. Test parameters: counterbody - steel ball; ball diameter 3-6 mm; load not less than 5 N; rotation speed not less than 0.02 m/s; track radius not less than 2 mm; track length not less than 60 m. Tests shall be carried out in dry friction mode at room temperature. After the ball-on-disc friction test, determine the wear rate and area using profilometry in accordance with ISO 13565. Result: graphs of the friction coefficient versus friction distance in PDF format, wear rate and area, as well as these graphs of the friction coefficient versus friction distance in electronic format (file extension txt). Test specimens for abrasive wear in accordance with GOST 23.208-79 "Unified Testing System." Method for Determining Abrasive Wear. Tests must be conducted using appropriate equipment under controlled conditions, with all parameters influencing the results (load, type of abrasive, sample weight before and after testing, etc.) recorded. Result: a brief description of the test methodology and presentation of the obtained data in tabular form.	Conducting a comprehensive study of the elemental-phase composition and tribological properties of coatings on the surface of stainless steels and heat-resistant nickel alloys obtained by plasma surfacing and thermal spraying, as well as samples after treatment by ion-plasma nitriding.	3900000	1	3900000	August-October	50/50	Поставлено
BR24992870	Welding materials, equipment and tools for welding and grinding works	MP-3 ARS Electrodes, 3mm Diameter, 2.5kg Pack (5kg) - 9,400 MP-3 ARS Electrodes, 5mm Diameter, 5kg Pack (10kg) - 18,600 309LSI Stainless Steel Wire, 1.2mm Diameter (5kg) - 41,000 LC1230N Metal Cutting Saw (1pc) - 397,060 SV-08G2S Welding Wire, 1.2mm Diameter (18 pcs) - 26,406 AG-125 SGM Angle Grinder (1pc) - 22,230 AIR-25 Compressor (24L, 206L/min input, 1.5 kW, 220V)/Aurora (1pc) - 88,350 Welding mask "Chameleon" A777c (9-13DIN) KAZAKHSTAN (3 pcs) - 26,300 Aluminum wire ER5356, 1.2 mm dia. (5 kg) - 30,000 Electrode holder DE 2300 (512.D070) (1 pc) - 12,950 Welding hammer with spring handle (1 pc) - 1,700 Cutting wheel 125 x 1.6 x 22 mm A646R (340946) (10 pcs) - 8,250 Cutting wheel 150 x 1.6 x 22 mm A46TZ Special (241472) (10 pcs) - 12,000 3M™ reusable half mask, size M, model 6200 (3 pcs) - 23,700	The procurement of a complete welding equipment set, materials, and accessories is necessary for welding, cutting, and grinding operations during the fabrication, assembly, and repair of experimental prototypes, as well as for the preparation and processing of metal structures for experimental research and process debugging. This ensures the ability to perform high-quality and safe welding and metalworking operations during the preparation of parts and assemblies used in experimental and production work.	775000	1	775000	August-October	50/50	Поставлено
BR24992870	Spectrometer ATP3034	Detector type: linear CMOS sensor with UV extension Effective number of pixels: 4096 Pixel size: 7 x 200 µm Sensitivity: — Dark noise: 13 RMS at 13°C Maximum spectral range: 400-645 nm Optical resolution: 0.26-0.47 nm Signal-to-noise ratio: >450:1 Dynamic range: 3000:1 Optical design: symmetrical M-shaped Czerny-Turner optical path Entrance slit: 5 µm Input interface: SMA905 connector Integration time: 1 ms – 65 s Frame rate: 100 fps Data transfer interface: Type-C or UART ADC Resolution: 16-bit Power Supply: USB, DC 5 V ±5% Operating Current: 170 mA (typ.) Operating Temperature: -10 °C to +50 °C Operating Humidity: <90% RH (non-condensing)	The rationale for purchasing the ATP3034 spectrometer is the need to equip the laboratory with a modern, high-resolution instrument for optical spectral analysis, enabling relevant scientific research and academic work in materials science, photonics, and condensed matter physics. The ATP3034 spectrometer enables measurements of emission, absorption, and reflectance spectra in the ultraviolet, visible, and near-infrared regions, which is particularly important when studying functional coatings, thin films, and nanostructured materials, as well as when analyzing the luminescent properties and characteristics of light sources. The instrument's high spectral resolution and a linear detector with a large number of pixels ensure precise separation of narrow spectral lines and high reproducibility of results, which directly impacts the quality of scientific publications and the reliability of experimental data.	2794000	1	2794000	December-January	100%	Поставлено
BR24992870	Means of protection	3M™ SecureFit™ 3700 SF3701SGAF-BLU-EU Protective Goggles with Scotch Coating over Corrective Glasses - 5 pcs 3M™ PELTOR™ Optime™ I H510P3E-405-GU Earmuffs with Helmet Clip - 8 pcs Chameleon Welding Helmet A777c (9-13 DIN) KAZAKHSTAN - 3 pcs Series 6000 Half Mask, Model 6300, Size L - 5 pcs 3M Ser 6000 Mask, Mod 6800, Size 4 - 2 pcs Filtering Half Mask 8102, Protection Class FFP2 NR D. (12 MAC), Dome - 120 pcs Sleeve III-9-2, 0 GOST 9356-75 RUBIKON - 50 m Sleeve I-9-2, 63 GOST 9356-75 RUBIKON - 50 m Cable KG 1*16 - 10 m Brown apron - 1 pc AuroraPro AIRHOLD 45 plasma cutting machine (MOSFET) - 1 pc	3M™ SecureFit™ 3700 Safety Goggles are essential for protecting eyes from mechanical particles and spatter during manufacturing and welding work. 3M™ PELTOR™ Optime™ I Hard Hat Earmuffs are designed to reduce noise levels and prevent occupational hearing loss when working in noisy environments. Chameleon Welding Helmet A777c (9-13 DIN) is used to protect the welder's eyes and face from intense light, sparks, and molten metal spatter. 6000 Series Half Mask Model 6300, Size L is necessary for respiratory protection from harmful aerosols and gases during welding and metalworking. 3M Series 6000 Mask Model 6800 provides enhanced respiratory and eye protection when working in dusty and gas-polluted environments. The 8102 FFP2 NR D filtering half mask is designed to protect the respiratory system from solid and liquid aerosols with concentrations up to 12 times the MAC. The III-9-2.0 hose (GOST 9356-75 RUBIKON) is used to deliver water or air in technological and industrial processes. The I-9-2.63 hose (GOST 9356-75 RUBIKON) is required for transporting working media in accordance with production equipment requirements. The KG 1×16 cable is used to connect welding and plasma equipment to power sources. The brown apron is designed to protect workers from sparks, metal spatter, and contamination during welding and assembly work. The AuroraPro AIRHOLD 45 plasma cutting machine is necessary for precise and efficient metal cutting during production and repair work.	660070	1	660070	December-January	100%	Поставлено
BR24992870	Material and technical resources for performing production work	UM-34 Magnetic Square - 3 pcs DENZEL Magnetic Welding Clamp, 25mm Force - 1 pc DENZEL Magnetic Welding Clamp, 50mm Force - 1 pc 500mm Yellow Square - 3 pcs 100mm Metal Ruler - 3 pcs Terminator Electrical Tape - 10 pcs 8*3mm Chain - 10 pcs Resanta TEPK-3000K Electric Heat Gun - 1 pc ESHM 125 Vikhr Grinder - 1 pc Medical Gloves - 300 pcs Proclass 70/80W Lamp - 1 pc Resanta OK-2000SN Convector - 1 pc Oxygen Pressure Regulator - 1 pc	The items being purchased relate to tools, equipment and consumables required to ensure the performance of welding, metalworking and auxiliary production work.	119600	1	119600	December-January	100%	Поставлено

Барлығы: 33 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22683114	Plasma cutting machine	The plasma cutting machine is designed for highly efficient and precise cutting of metals in industrial and installation conditions. The net weight of the unit is 27 kg, while the packed weight is 32 kg. The dimensions of the machine (L × W × H) are 550 × 280 × 490 mm, and the package dimensions are 575 × 335 × 645 mm. The warranty period is 60 months. The compressed air pressure is 5 bar. The cutting current range is from 30 to 100 A. The unit is equipped with overheating protection and a protective cover for the control panel. The protection class is IP21S. The maximum power consumption is 23 kVA, and the maximum input current is 25.3 A. The maximum cutting thickness for steel is up to 20 mm. The machine features a pilot arc and a handle for easy transportation. The supply voltage is 400 V ±15 %, and the no-load voltage is 270 V. The duty cycle at maximum current is 60 %. The air consumption is 230 L/min. The operating temperature range is from −10 to +40 °C. The arc ignition type is HF, non-contact. The machine is equipped with an air purge function and a digital display.	Equipment is necessary to implement	490306	1	490306		100%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP19175164	Scientific research service	Purchase of stationery	for the implementation of the project and the preparation of the final report	53010	1	53010		100%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP22684076	Procurement of materials, equipment, and/or software	Whey protein concentrate – 2 pieces	To provide an experiment.	40	1	40	April	100%	В период поставки
AP22684076	Procurement of materials, equipment, and/or software	Cold pressed cedar oil (Katon-Karagay) - 0.5 l	To provide an experiment.	30	1	30	April	100%	В период поставки
AP22684076	Procurement of materials, equipment, and/or software	Supergel 1000 (Carrageenan) - 2 pcs.	To provide an experiment.	20	1	20	april	100%	В период поставки
AP22684076	Procurement of materials, equipment, and/or software"	Beef 1 category - 30 kg	To provide an experiment.	90	1	90	april	100%	В период поставки
AP22684076	Procurement of materials, equipment, and/or software"	Horse meat, 1st grade – 30 kg"	To provide an experiment.	105	1	105	april	100%	В период поставки
AP22684076	Procurement of materials, equipment, and/or software	50 ml volumetric flask – 6 pieces"	To provide an experiment.	12	1	12	april	100%	Поставлено
AP22684076	Procurement of materials, equipment, and/or software	Artificial sausage casing – 4 pieces	To provide an experiment.	10	1	10	April	100%	Поставлено
AP22684076	Procurement of materials, equipment, and/or software	Spice and seasoning mix – 3 pieces	To provide an experiment.	8	1	8	April	100%	Поставлено
AP22684076	Scientific research service	Laboratory services for determination of fatty acid composition	To provide an experiment.	20000	3	60000		100%	В период поставки

Барлығы: 9 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22686900	Purchase of office supplies	A4 paper ILIM “Standard C” – 3 pcs. Blue ballpoint pen 0.5 mm – 1 pcs.	for the implementation of the project and the preparation of the final report	13900	1	13900		100%	В период поставки

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
BR24992940	Laptop Apple MacBook Air A3114	Processor Apple M1 Pro (10-core) Graphics Apple M1 Pro (16-core GPU) RAM 16 GB Unified Memory SSD 512 GB Display 16.2", Liquid Retina XDR, 3456×2234, 120 Hz, up to 1600 nits Ports 3× Thunderbolt 4, HDMI, SDXC, MagSafe 3, 3.5 mm Battery 100 Wh, up to 21 hours of video playback, fast charging Camera/Audio 1080p FaceTime, 6-speaker system Dimensions/Weight ~35.6×24.8×1.68 cm / ~2.15 kg Color Space Gray	The device, with high performance and energy efficiency, ensures stable operation with resource-intensive professional software, which is essential for the effective completion of project and research tasks.	901968	2	1803936	-	50/50%	В период поставки
BR24992940	Animal feed - hay	Color - from green to yellow-green or green-brown. Appearance - no signs of moldiness, no moldy layers. Smell - no signs of musty, moldy, putrid or other foreign odors. Content of harmful and poisonous plants no more than 1%. The presence of foreign impurities, including clods of earth, stones, fuels and lubricants - is not allowed. Consistency - non-smearing, without sliminess. Content of crude protein, g / kg dry matter (DM), not less than: 120-90. Content of crude fiber, g / kg dry matter, not more than: 290-320. Content of acid-detergent fiber, g / kg dry matter, not more than: 380-430. Neutral detergent fiber content, g/kg dry matter, no more than: 650-720. Crude ash content, g/kg dry matter, no more than 100-90. Dry matter content, g/kg, no less than 830. Metabolic energy content*, MJ/kg DM, no less than: 8.9-7.9. Delivery of goods in bales, no less than 20 kg in one bale. Quantity of goods purchased = 4,787 tons	for animal feeding	144378	1	144378		100%	В период поставки

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23486449	AA-7000 spectrometer complete with Fe, Cd, Pd lamps	The spectral range is 185-900 nm. A three-dimensional two-beam optical circuit using a digital optical filter and elements that reduce radiation loss.	For research, for agriculture and food industry, for quality control, determination of heavy metals.	30	1	30	july	50/50%	Поставлено
АР23486449	Laboratory services	Determination of fatty acid composition in 2 samples Determination of fat-soluble antioxidants in 1 sample Determination of water-soluble antioxidants in 1 sample	In pursuance of the calendar plan	70000	1	70000	may	100%	Поставлено

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23485656	The MLS400 Residual Current Device	The MLS400 device features a multi-layer protection system that provides automatic disconnection in case of electric shock risk, short circuit, or ground leakage. It includes automatic insulation, grounding control, and self-monitoring capabilities. The unit is highly sensitive, reliable, and has a fast response time of no more than 0.2 milliseconds. The operating input voltage range is 150–264 V, and the output voltage is 220±4 V.	The MLS400 Residual Current Device is designed to protect people—primarily the operator—from electric shock due to direct or indirect contact with live electrical parts, and also to safeguard laboratory equipment and installations from fault currents and harmful electrical impacts.	1	1	1	may	50/50%	Поставлено
АР23485656	Scientific research service	Developing a knowledge model using ontological modeling	This service is necessary to perform calendar tasks of the Program	1564295	1	1564295		100%	В период поставки

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR21882447	Radiation treatment service at ELV-4 and ILU-10 accelerators.	The total amount of radiation treatment services is 2 hours. The radiation dose is 3 kg, 6 kg, 9 kg. The name of the studied samples: beef meat, barley, wheat, bran, mixed feed.	For the implementation of paragraph 4.1 of the calendar plan for research and development.	300000	1	300000	april	100%	Поставлено
BR21882447	Monograph publication	Monograph Title: Development of a Food Safety System for Long-Term Storage Based on Electrophysical and Radiation Processing Methods Authors: D.R. Orynbekov, K.Zh. Amirkhanov, B.K. Asenova, Zh. Kalibekkyzy, A.N. Nurgazezova, G.N. Nurymkhan, N.R. Muslimova At present, ensuring the safety of food products and extending their shelf life are issues of global significance. The increase in microbiological contamination of food, challenges in transportation and storage conditions, as well as growing consumer demand for high-quality and safe products, all require the introduction of new technologies. In this context, electrophysical and radiation processing methods are considered scientifically and technologically grounded, effective approaches for preserving the freshness of food products—particularly meat and meat products—for extended periods. This monograph presents the theoretical foundations of electrophysical and radiation processing, the mechanisms of physicochemical impact, their effect on microbiological safety, and the results of specific experimental studies. In particular, scientifically based recommendations are provided for enhancing product safety and extending shelf life through treatment using low-energy electron irradiation.	In fulfillment of the points of the program's calendar plan."	520	1	520	Мау	50/50%	Поставлено
BR21882447	A4 office paper	A4 paper (210 × 297 mm), with a weight of 80 g/m², is made from wood pulp. It features high whiteness, delivering clean, high-contrast and sharp prints. The paper is compatible with copiers, laser and inkjet printers, and fax machines — it feeds smoothly without jams or double-feeds, produces minimal dust, and stays flat after printing. The pack contains 500 sheets.	Required for reporting work within the project	1693	2	3386	0	100%	В период поставки

Барлығы: 3 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23484846	Food Research	Within the framework of the scientific project, 8 samples of meat and meat semi-finished products will be investigated for: Determination of amino acid composition (arginine, lysine, tyrosine, phenylalanine, histidine, leucine+isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine) 1 by Capillary Electrophoresis, Determination of fatty acid composition by Gas Chromatography (GC), Determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc) by Capillary Electrophoresis, Determination of the amount of Vitamin C, Determination of iron, Determination of magnesium, Determination of calcium, Determination of iodine, Determination of lead, Determination of arsenic, Determination of potassium-40, Determination of cesium-137, Determination of TAMC (Total Aerobic and Facultative Anaerobic Microorganisms), Determination of BGKP (coliforms), Determination of pathogenic bacteria, including Salmonella, Determination of L. monocytogenes, Determination of sulfite-reducing clostridia.	The laboratory tests in question are a necessary stage of the scientific work, providing objective data on the quality and safety of radiation-processed meat semi-finished products. The results will be used for scientific reporting and the preparation of publications.	527600	1	527600	april	50/50%	Поставлено

Барлығы: 1 plan

Science Procurement

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

Notice

Science Procurement

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available

No Data Available